Labshake search
Citations for Thermo Fisher :
7401 - 7450 of 10000+ citations for Glutathione Reductase Fluorescent Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... RT-PCR was conducted using the Verso 1-Step RT-PCR Hot-Start kit (Thermo Fisher Scientific, Waltham, MA, USA). The primers used for RT-PCR were RGCP-NdeI-F (5’ ATGGCAAGGAAGAAGGGCAAATCGGCCA 3’ ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was made from 1 ug of RNA/sample using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). Each Ct value was measured using Lightcycler 480 (Roche ...
-
bioRxiv - Systems Biology 2023Quote: ... A second purification step was performed in a 1% agarose gell using the GeneJET Gel Extraction Kit (Thermo Fisher Scientific) to remove the original vector used as template in the PCR reaction ...
-
bioRxiv - Physiology 2023Quote: ... Complementary DNA (cDNA) was synthesized from 1 µg of total RNA using High-Capacity cDNA Reverse Transcription Kit (ThermoFisher, 4368813). Quantitative real-time PCR was performed using Itaq Universal SYBR green master mix (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... and 14 cycles of PCR amplification using the Ion Xpress™ RNA-Seq Barcode 1-16 Kit (Thermo Fisher Scientific). Yield distribution of the libraries was measured with the Qubit 1x dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 1 mL) and loaded onto a pre-equilibrated SCX column ICAT™ cartridge kit (Applied Biosystems-AB Sciex, USA, #4326752). The peptides were eluted using different concentrations (30 ...
-
bioRxiv - Genomics 2023Quote: ... cDNA was synthesized from 1-2 μg total RNA with the Multiscribe High-Capacity cDNA Reverse Transcription Kit (ThermoFisher 4368814).
-
bioRxiv - Biochemistry 2023Quote: ... A total 1 μg of extracted RNA was reverse transcribed using SuperScript IV VILO Master Mix kit (Thermo Fisher, USA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The quality of extracted DNA was visualized using 1% agarose gel electrophoresis and quantified using Quant-iT PicoGreen ds-DNA Assay kits (Thermofisher) and a fluorescent plate reader ...
-
bioRxiv - Developmental Biology 2022Quote: ... Purified RNA (1 μg) was used for reverse transcription using the High-Capacity cDNA Reverse Transcription kit (4368814, Applied Biosystems). Complementary DNA (cDNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... The mRNA from plasmid #1 and #2 was transcribed using the mMESSAGE mMACHINE SP6 Transcription Kit (Thermo Fisher Scientific, AM1340) and purified with the NucleoSpin RNA Clean-up XS kit (Macherey-Nagel ...
-
bioRxiv - Developmental Biology 2023Quote: ... Explants were incubated in the dark for 1 h in a click-kit reaction cocktail containing Azide Dye (Molecular Probes). This was followed by 3 washes in 3% BSA/PBS before imaging.
-
bioRxiv - Developmental Biology 2023Quote: Quantitative real-time PCR was performed using the TaqMan® RNA-to-Ct™ 1-Step Kit (Thermo Fisher, #4392653) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... and SXL (1:500, a gift from Fatima Gebauer) antibodies using the Western Breeze kit following the manufacturer’s protocol (ThermoFisher Scientific). We quantified the relative expression of protein for SXL using the gel analysis tool in ImageJ software following the website’s guidelines 90 ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized from 1 μg of DNAse-treated RNA using the Vilo cDNA synthesis kit (Invitrogen, Thermo Fisher Scientific). qPCR reactions were prepared with IDOL TaqMan assay (ID Hs00982312_m1 ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized from 1 μg of DNAse-treated RNA using the Vilo cDNA synthesis kit (Invitrogen, Thermo Fisher Scientific). qPCR reactions were prepared with IDOL TaqMan assay (ID Hs00982312_m1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... incubated after for 2’ at RT with Stop Reagent (1:11, in 1XPBS, Alexa Fluor 488 Tyramide SuperBoost Kit, goat anti-rabbit IgG, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... washed again two times in 1XPBS 5’ each and incubated with Alexa Fluor Tyramide 594 (1:100, Alexa Fluor 594 Tyramide SuperBoost Kit, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Cells were subsequently stained with surface antibodies and then either fixed using 1% paraformaldehyde or permeabilized using a FoxP3/Transcription factor fixation/permeabilization kit (ThermoFisher). Samples undergoing permeabilization were then stained with intracellular antibodies ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were stained for 10 min in 0.5 µL/mL calcein-AM and 2 µL/mL ethidium homodimer-1 from the Live/Dead assay kit (L3224, Invitrogen). Then ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of RNA was reverse transcribed with the High-Capacity cDNA Reverse Transcription Kit (Thermo Scientific, Waltham, MA, USA). The amplified cDNA was diluted to 10 ng/μl ...
-
bioRxiv - Plant Biology 2023Quote: RNA in situ hybridization was conducted using Invitrogen ViewRNA ISH Tissue 1-Plex and 2-Plex Assay kits (ThermoFisher Scientific) using the manufacture’s protocol optimized for Medicago root and nodules sections (Kulikova et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ml of the cell suspension was utilized to extract total RNA using the Ribopure-Yeast RNA kit (AM1926, Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: The nuclear lysate was prepared from HL-1 cells or fresh LV tissue as per standard protocol (Thermo Scientific kit). TransAM p65 NF-κB activation assay was performed using nuclear lysate as per standard protocol (Active Motif) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was synthesized with 1 μg of RNA as template employing the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). Quantitative PCR was carried out in a LightCycler 480 instrument (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... Commercially available kits were used for assessment of the levels of Myeloperoxidase (Cat #EMMPO) and PAI-1 (Cat# EMSERPINE1) purchased from Invitrogen, TPA (Cat# ab233615 ...
-
bioRxiv - Neuroscience 2023Quote: ... Fly brains and iPSC cells were incubated in 1-μM MitoSox red dye (kit #M7514, Thermo Fisher Scientific, Waltham, MA) for 15 mins ...
-
bioRxiv - Neuroscience 2023Quote: Fly brains were dissected and incubated in 1-μM MitroTracker red dye (kit #M-7512, Thermo Fisher Scientific, Waltham, MA) for 15 mins ...
-
bioRxiv - Biochemistry 2023Quote: ... Residual DNA was removed from RNA samples (1 µg of total RNA input) using the DNA Free kit (Ambion Inc.) before cDNA synthesis using the iScript cDNA synthesis kit (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μg of RNA was used to generate cDNA with a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368813) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: HTLV-1-infected T cell clones were stained with LIVE/DEAD Fixable Near-IR Dead Cell Stain kit (Invitrogen, L34976) to enabling gating on live cells and then crosslinked in phosphate-buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2023Quote: Exosomes were isolated from 1 ml of serum using a Total Exosome Isolation Kit (Invitogen, Thermo Fisher Scientific Inc., USA), according to the manufacturers protocol ...
-
bioRxiv - Cancer Biology 2023Quote: Mitochondrial depolarization was assessed on cells exposed to Venetoclax for 24h using the MitoProbeTM JC-1 assay kit (ThermoFisher, M34152) following manufacturer recommendations ...
-
bioRxiv - Genomics 2023Quote: ... SYBR Green qPCR was prepared using the Power SYBR Green RNA-to-CT 1 step kit (Applied Biosystems, Cat# 4391112) and specific SOX6 primers (mSOX6_F and mSOX6_R ...
-
bioRxiv - Developmental Biology 2023Quote: ... Protein pellets were resuspended in 1% SDS and protein concentration was measured using the Bradford assay kit (Thermo Scientific, 1863028), according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... cDNA was synthesized from 1 µg of DNase-treated RNA using the Verso cDNA Synthesis Kit (Thermo Scientific, Waltham, MA). The dsRNA sequence region of each gene was amplified with the gene-specific primer pair using Q5 high-fidelity PCR (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding heavy and light chains were transfected into Expi293F cells in a 2:1 mass ratio using an ExpiFectamine 293 transfection kit (Gibco). Six days post-transfection ...
-
bioRxiv - Pathology 2024Quote: ... Reverse transcriptions were performed from 1 µg RNA according to the manufacturer’s protocol (High-capacity RNA to cDNA kit, Applied Biosystems), using random priming ...
-
bioRxiv - Genomics 2024Quote: ... The whole transcriptome library was amplified and barcoded using the IonXpressTM RNA-Seq Barcode 1-16 Kit (Thermo Fisher Scientific). The quantity of the amplified whole transcriptome library was assessed using the Ion Library TaqManTM Quantitation Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... and the success of the gene editing method was assessed using the T7 Endonuclease 1 (T7E1) assay kit (Invitrogen, Germany). Positive individuals from the resulting F1 generation were then crossed with wild-type fish to produce the F2 generation which were screened again with T7E1 assay ...
-
bioRxiv - Cell Biology 2024Quote: qPCR was performed on cDNA generated with 1 µg of RNA with Maxima First Strand cDNA Synthesis Kit (ThermoFisher #K1672) according to the manufacturer’s recommendation ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 μg of RNA was reverse transcribed into cDNA using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, 4368814). Primers used to amplify the FH2 domains of DAAM1 are provided in Table S1 ...
-
bioRxiv - Microbiology 2024Quote: Multiplex immunoassay was performed using a Luminex bead-based multiplex ELISA kit (ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex, reference # EPXR260-26088-901, Invitrogen). Each sample was normalized to the total protein concentration determined by Bicinchoninic acid (BCA ...
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR reaction mixtures were set up with reagents from the Power SYBR Green RNA-to-Ct 1-step kit (ThermoFisher) with 25-50ng RNA per reaction and primers are listed in Table S2 ...
-
bioRxiv - Neuroscience 2024Quote: ... About 1 μg of RNA was used for cDNA preparation using the High-Capacity cDNAReverse Transcription Kit (4374966, Applied Biosystems). qRT-PCR was performed using Fast SYBR Green Master Mix (4309155 ...
-
bioRxiv - Plant Biology 2024Quote: cDNA was synthesized from 1 µg of total RNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) following the manufacturer’s instructions and samples were stored at −20°C until used ...
-
bioRxiv - Neuroscience 2024Quote: ... and EGFP with 2:2:1 (total 0.5 µg / coverslip) using the Lipofectamine 3000 transfection reagent kit (Thermo Fisher Scientific). Transfected cells were identified by EGFP signals ...
-
bioRxiv - Cancer Biology 2024Quote: ... Isolated RNA (1 mg, quantified with NanoDrop) was reverse transcribed applying the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) following the manufacturer’s protocol ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... ExpiCHO cells were transiently transfected with the vector containing the gene encoding soluble spike glycoprotein ectodomain or CR3022 (using a heavy chain:light chain ratio of 1:2) using the Expifectamine 293 Transfection Kit (ThermoFisher #A29129), following the user manual ...
-
bioRxiv - Microbiology 2024Quote: ... DNA for genotyping was extracted from whole blood (>1% parasitemia) typically using the Qiagen DNAeasy or GeneJet Genomic DNA purification kit (Thermofisher).