Labshake search
Citations for Thermo Fisher :
7301 - 7350 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and pVSV-G (390 ng) packaging plasmids in 5 × 105 HEK293T cells with Lipofectamine 2000 (Invitrogen). The supernatant was collected 40 hours later ...
-
bioRxiv - Cancer Biology 2024Quote: ... was used to perform qPCR in triplicates using the QuantStudio 5 Real-Time PCR System (ThermoFisher). Data were normalized against Gapdh.
-
bioRxiv - Molecular Biology 2024Quote: Unfragmented UHRR or HEK-293T RNAs (5 μg) were DNased with 2 U TURBO DNase (Invitrogen) and purified using an RNA Clean & Concentrator kit (Zymo Research ...
-
bioRxiv - Plant Biology 2024Quote: ... Total 5 nmol of biotinylated RNAs mixed with 50 μL of Dynabeads M-280 streptavidin (Invitrogen) were washed with Citrate-Phosphate buffer (pH 5.0 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µg of antibodies were irreversibly crosslinked to Dynabeads Protein A or Protein G (Thermo Fisher) using 5 mM BS3 (ProteoChem ...
-
bioRxiv - Physiology 2024Quote: ... Mobile phase A was 5% acetonitrile in water with 10 mM ammonium acetate (Thermo Fisher Scientific) with pH = 9.8 ...
-
bioRxiv - Physiology 2024Quote: ... Slides underwent three 5-minute PBS washes and incubated with secondary antibodies (Invitrogen, Thermo Fisher Scientific): MHC I ...
-
bioRxiv - Physiology 2024Quote: ... Slides underwent three 5-minute PBS washes and incubated with secondary antibodies (Invitrogen, Thermo Fisher Scientific): MHC I ...
-
bioRxiv - Physiology 2024Quote: ... and the pellet was resuspended in 5 ml of red blood cell lysis buffer (Thermo Fisher) and incubated at room temperature for 5 minutes ...
-
bioRxiv - Pathology 2024Quote: H9C2 rat myoblast cells (passage 5 to 15) were cultured in monolayers in MEMα medium (Gibco), supplemented 10% fetal bovine serum (Sigma) ...
-
bioRxiv - Biochemistry 2024Quote: ... The peptides were injected onto a PepMap Neo (5 μm C18, 50 × 0.30 mm, Thermo Scientific) trap cartridge ...
-
bioRxiv - Molecular Biology 2024Quote: ... and secondary antibody coupled to Alexa Fluor 488 (1:1000, 5% BSA PBS, Invitrogen A11008, goat). DAPI counterstaining and ProLong mounting (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... male) were grown at 37°C and 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) supplemented with 10% fetal bovine serum (EUROBIO ...
-
bioRxiv - Molecular Biology 2024Quote: ... the peptides were sampled on a precolumn (300 μm x 5 mm PepMap C18, Thermo Scientific) and separated in a 75 μm x 250 mm C18 column (Reprosil-Pur 120 C18-AQ ...
-
bioRxiv - Neuroscience 2024Quote: ... we punched a 5 mm retina sample with a disposable biopsy punch (Fisher Scientific, Hampton, NH) on a 3D-printed lens attachment ...
-
bioRxiv - Microbiology 2024Quote: ... bacteria from each suspension were isolation streaked onto a TSA/5% sheep blood agar plate (ThermoFisher). Following overnight incubation in ambient air at 35°C ...
-
bioRxiv - Microbiology 2024Quote: ... Three 5-minute washes with block were done prior to incubation in secondary antibodies (Thermo Fisher Scientific Alexafluor goat anti-mouse 488 and Alexafluor goat anti-rat 594 ...
-
bioRxiv - Microbiology 2024Quote: ... tightly synchronised parasites were incubated in 20 μM 5-ethynyl-2-deoxyuridine (EdU, Thermo Fisher Scientific) for 7.5 minutes ...
-
bioRxiv - Immunology 2024Quote: ... Then digested in DMEM– 5% fetal bovine serum (FBS) containing collagenase I (Life Technologies, Carlsbad, CA), as we previously described (5 ...
-
bioRxiv - Microbiology 2024Quote: ... PCR amplification was achieved using a QuantStudio™ 5 Real-Time PCR System (ThermoFisher Scientific, UK) at optimized PCR conditions of 52°C for 10 minutes ...
-
bioRxiv - Genomics 2024Quote: ... 30 pmol of MS2 reverse primer (5’CGCTTGTAGGCACCTTGATC) with 0.4 mM dNTPs (ThermoFisher Scientific; ref. R1121) were allowed to anneal to 100 ng of MS2 RNA (Roche ...
-
bioRxiv - Immunology 2024Quote: ... Mice were imaged 5 minutes after intraperitoneal injection with D-luciferin (150 mg/kg) (Thermo Scientific). Luciferase signal was quantified using Living Image software (Caliper LifeSciences) ...
-
bioRxiv - Genomics 2024Quote: ... Cells were maintained at 37°C in 5% CO2 in RPMI1640 (Thermo Scientific, catalog no. 11875135) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Synthetic Biology 2024Quote: ... These cell lines were engineered in parallel and selected with 5 µg/mL blasticidin (Gibco, R21001). After the ratiometric barcode readout revealed that the majority of the cells had barcode arrays inserted ...
-
bioRxiv - Immunology 2024Quote: ... were co-cultured with (i) apoptotic cells pre-labelled with 5 μM pHrodo Red SE (Invitrogen) in a 1:5 ratio of macrophages to apoptotic cells ...
-
bioRxiv - Immunology 2024Quote: ... The cells were cultured and stimulated with anti-CD3 (clone 145-2C11; ThermoFisher, 5 µg/mL) and anti-CD28 (clone 37.51 ...
-
bioRxiv - Cell Biology 2024Quote: ... incubated in DAPI for 5 min at RT and mounted with coverslips using Prolong Gold (Invitrogen). Primary antibodies used were ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were stained with primary antibodies (see Methods Table 1) in 5% FBS (Thermo Fisher Scientific) and 0.2% Triton X-100 (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... then blocked with blocking buffer (3% bovine serum albumin with 5% normal goat serum (Gibco, 16210064), and 5% normal donkey serum (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... and centrifuged twice at 200 g for 5 min each in advanced DMEM/F12 (Gibco; 12634010) to remove residual Matrigel or stem cell culture media components ...
-
bioRxiv - Bioengineering 2024Quote: ... and centrifuged twice at 200 g for 5 min each in advanced DMEM/F12 (Gibco; 12634010) to remove residual basement membrane and mTeSR1 media ...
-
bioRxiv - Genomics 2024Quote: ... 5’-capped in vitro mRNA was generated using the MEGAshortscript transcription kit (Thermo Fisher, Waltham, MA) following the manufacturer’s protocol with a 3.5 h 56°C incubation with T7 or SP6 RNA polymerase ...
-
bioRxiv - Genetics 2024Quote: ... The reaction mixture consisted of 5 µl of 2x SYBR Green master mix (ThermoFisher Scientific, Germany), 1 µl of 10 µM forward primer and 1 µl of 10 µM reverse primer (Supplementary Table S2) ...
-
bioRxiv - Genomics 2024Quote: ... Samples were incubated for 5 minutes on ice and 100µl chloroform (Cat# J67241.K2, Thermo Scientific) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... iPSCs were split by incubating for 3-5 min at +37 L in EDTA (15575020, Invitrogen) and kept in 5 µM Y-27632 2HCl (S1049 ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were cultured at 37 °C and 5% CO2 in RPMI 1640 medium (Thermo Fisher Scientific) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 10% calf bovine serum with iron and 5% penicillin/streptomycin (all sourced from Gibco). Regular mycoplasma tests performed on the culture medium yielded negative results.
-
bioRxiv - Bioengineering 2024Quote: ... type I bovine atelocollagen solution (either 5 mg/mL, Gibco; or 10 mg/mL, Advanced BioMatrix) was neutralized on ice following instructions from the manufacturers ...
-
bioRxiv - Biophysics 2024Quote: ... and cultured at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) (21063029, Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Biophysics 2024Quote: ... permeabilized cells were blocked with a solution of 5 v/v% Fetal Bovine Serum (FBS, Gibco) and 1 w/v % Bovine Serum Albumin (BSA ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were cultured at 37 °C and 5% carbon dioxide in high glucose DMEM (Fisher Scientific) with 10% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: Paraffin blocks were cut into 5 µm thick sections using a microtome (Thermo Fisher Scientific, HM355S). Hematoxylin and eosin (H&E ...
-
bioRxiv - Cell Biology 2024Quote: The breast cancer tissues were minced and digested with 5 mL of TrypLE (Gibco 12605- 010) digestion solution at 37 °C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were selected for 5 days with 1 µg/mL puromycin (cat. no. A1113803, ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... cells were maintained at 37C and 5% CO2 in phenol-free DMEM/F-12 media (Gibco) supplemented with 20 mM HEPES ...
-
bioRxiv - Cell Biology 2024Quote: ... and the pellet was resuspended in 5 mL of ACK lysis buffer (Thermo Fisher Scientific A1049201) to lyse red blood cells and incubated for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid or siRNA transfections in A549 and MRC-5 cells were performed using Lipofectamine 3000 (Invitrogen) or the riboFECT CP Transfection Kit (RiboBio ...
-
bioRxiv - Cell Biology 2024Quote: U2OS cells were grown at 37°C in 5% CO2 in DMEM low glucose (11885; Gibco) supplemented with 10% heat inactivated FBS (F4135 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then incubated with pre-warmed PBS buffer containing 5 μM CM-H2DCFDA (Thermo Fisher: #C6827) probe for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Blocking was performed in 5% milk with 0.1% Triton X-100 in 1x PBS (TBST) (Gibco) for 1 hour at room temperature under shaking ...