Labshake search
Citations for Thermo Fisher :
7351 - 7400 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and the pellet was resuspended in 5 mL of ACK lysis buffer (Thermo Fisher Scientific A1049201) to lyse red blood cells and incubated for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: The breast cancer tissues were minced and digested with 5 mL of TrypLE (Gibco 12605- 010) digestion solution at 37 °C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were selected for 5 days with 1 µg/mL puromycin (cat. no. A1113803, ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2024Quote: ... Blocking was performed in 5% milk with 0.1% Triton X-100 in 1x PBS (TBST) (Gibco) for 1 hour at room temperature under shaking ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then incubated with pre-warmed PBS buffer containing 5 μM CM-H2DCFDA (Thermo Fisher: #C6827) probe for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... with samples assayed on a QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific, USA) utilizing a 384-well block in duplicates ...
-
bioRxiv - Cancer Biology 2024Quote: ... They were incubated with 5 µL (0.25 µg) APC-eFluor780-CD34 (Thermo Scientific, 47-0349-41), PerCP-eFluor710-CD38 (Thermo Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... lysed via repetitive pipetting with TRIZOL reagent (Ambion; 1mL reagent per 5-10 x 106 cells), and allowed to stand at room temperature for 5 min to ensure complete disassociation ...
-
bioRxiv - Molecular Biology 2024Quote: ... the PCR reaction was prepared using 5 µL of PowerUp SYBR Green Mix (Thermo Fisher Scientific), 1 µL each of 500nM primer (forward and reverse) ...
-
bioRxiv - Cell Biology 2024Quote: ... 175 ± 5 nm green-fluorescent microspheres (PS-Speck Microscope Point Source Kit; Molecular Probes, Eugene, USA) were diluted 1:1000 in MilliQ and sonicated for 2 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were washed with PBS then incubated with 5 μM Carboxy Fluoroscein Succinimidyl Ester (CFSE, Invitrogen) in PBS for 15 min at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... samples were washed and incubated with BODIPY 493/503 (5 μg/ml in PBS; Invitrogen, D3922) for 25 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% CO2 and 95% relative humidity on gelatin coated dishes in KnockOut DMEM (Thermo Fisher Scientific) supplemented with 15% FCS (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Slides were then washed 3x 5 minutes in PBS before the secondary antibody (Alexa range, Invitrogen) at 1:200 dilution in TNB was added for 2 hours at RTSlides were mounted in Mowiol 4-88 (Applichem ...
-
bioRxiv - Plant Biology 2020Quote: ... T-DNA left border (LB) end primers (Supplemental Table 5) and DreamTaq DNA polymerase (Thermo Fisher Scientific). The cycle settings used for the TAIL-PCR reactions were adjusted based on the characteristics of the polymerase and primers used and listed in Supplemental Table 6 ...
-
bioRxiv - Microbiology 2020Quote: ... bacilliformis shifted to liquid medium at pH 7 using a 5’ RACE System kit (Invitrogen; Carlsbad, CA) according to manufacturer’s protocols and with gene-specific primers (S1 Table) ...
-
bioRxiv - Microbiology 2020Quote: ... was used at 1:4000 in 5% milk and exposed with SuperSignal West Dura substrate (Thermo Fisher).
-
bioRxiv - Biophysics 2021Quote: ... The cleared supernatant was applied onto a 5 ml ml HisPure™ Ni-NTA resin (Thermo Scientific) gravity-based column equilibrated with 10 column volumes of buffer A ...
-
bioRxiv - Cancer Biology 2021Quote: ... After washing three times with MACS buffer consisting of PBS supplemented with 5 % FCS (Thermo Fisher Scientic) and 2 mM EDTA to remove unbounded cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... and quantified using TaqMan qPCR probes for the 25 TAS2R genes and UBC1 (QuantStudio 5; ThermoFisher Scientific).
-
bioRxiv - Developmental Biology 2021Quote: ... passage 5 cells were selectively detached and dissociated into single cells using TrypLE express (Thermo Fisher Scientific) as previously described ...
-
bioRxiv - Systems Biology 2020Quote: ... Then cells were incubated with 5 μg/mL Cy5 labeled goat-anti-rabbit (Thermo Fisher Scientific; A16112) in 1% (wt/vol ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 8.3) simultaneously with a 5-fold molar excess of Alexa Fluor 647 NHS Ester (ThermoFisher, A20006) and a 5-fold molar excess of EZ-Link NHS LC-LC-Biotin (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: The 5’ and 3’ ends of lncRAP2 was determined using the FirstChoice RLM-Race Kit from Ambion following the manufacturers instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl of reverse transcription mix (50 mM Tris-HCl, pH 8.3 [Sigma], 75 mM NaCl [Ambion] ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were fixed for 5 min at room temperature with 1 % methanol-free formaldehyde (Thermo Scientific, #28906). Cells were lysed using ice-cold Farnham lab buffer supplemented with complete protease inhibitor cocktail (#4693159001 ...
-
bioRxiv - Cell Biology 2020Quote: Fixed HUVEC were blocked for 1hr at RT in blocking solution (5% FBS, 2X antibiotic-antimycotic (Gibco), 0.1% sodium azide (s2002-100G ...
-
bioRxiv - Cell Biology 2020Quote: MCF10A cells were cultured in Dulbecco’s Modified Eagle Medium:F12 (DMEM:F12) supplemented with 5% donor horse serum (Gibco), 10 μg/mL insulin (Actrapid ...
-
bioRxiv - Cell Biology 2020Quote: ... for 30 minutes at 37°C and 5% CO2 and counterstained with 1:10,000 Hoechst (Thermo Fisher). Parameters were set as follows ...
-
bioRxiv - Genetics 2021Quote: ... 500 µl of cell suspensions (5×105 cells/ml) were transferred to cell chambers (Invitrogen A-7816) containing coverslips treated with 0.25mg/ml concanavalin A (Sigma-Aldrich C0412 ...
-
bioRxiv - Genetics 2021Quote: ... at density of 5×103 cells/well in 100 μl DMEM-Glutamax supplemented with 10% FBS (Gibco) and penicillin-streptomycin (10 μg/ml ...
-
bioRxiv - Genetics 2021Quote: ... The sections were then incubated with Alexafluor 488-conjugated claudin-5 monoclonal antibody (4C3C2, Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... at a 1:1:1 ratio (5 mg each) using 250 ml of Opti-MEM (Gibco, 31985088) and 45 ml (1 mg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of total siRNA were transfected into macrophages using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: HAP1 cells were grown at 37°C with 5% CO2 in IMDM (Gibco; 4.5 g/L glucose) supplemented with 10% fetal bovine serum (PAN biotech) ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 5 min at RT and the signal was captured with X-ray film (Thermo Fisher, 34090) for 5-60 sec ...
-
bioRxiv - Biochemistry 2020Quote: ... pH 7.6) containing 5% milk followed by incubation with mouse Engelbreth-Holm-Swarm (EHS) laminin (ThermoFisher, 23017015) overnight at a concentration of 7.5 nM at 4°C in LBB containing 3% bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2020Quote: HAP1 cells were maintained at 37°C and 5% CO2 in Iscove’s Modified Dulbecco’s Medium (IMDM, Gibco) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mm diameter gut punches were made and preserved in RNAlaterTM solution (Thermo Fisher Scientific Waltham, MA). RNA was extracted from tissue samples using the Qiagen RNeasy MiniKit (Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were washed with PBS and then simultaneously blocked and permeabilized with 5% normal goat serum (ThermoFisher) in 0.5% Triton X-100 (Serva ...
-
bioRxiv - Developmental Biology 2020Quote: ... incubated with DAPI for 5 min in PBS and washed twice before mounting with Prolong Gold (Invitrogen). Cells were imaged on a Zeiss Imager.Z2 microscope using the ApoTome.2 structured illumination platform ...
-
bioRxiv - Immunology 2022Quote: ... The beads were washed again with PBS using magnets and resuspended in 5% Pluronic F-68 (Gibco) PBS solution and incubated for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... HCT116 cells complemented with chromosomes 3 and 5 were cultured with 400 μg/mL geneticin (G418, Gibco) and 6 ug/mL blasticidine (Invivogen) ...
-
bioRxiv - Physiology 2022Quote: ... samples were sectioned transversely at 5 μm thickness using a HM325 manual rotary microtome (Thermo Fisher Scientific). H&E staining was processed with Varistain TM Gemini ES Automated Slide Stainer (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... Neurons were incubated with 5 μM Fura-2 AM and 0.04% Pluronic F-127 (Thermo Fisher Scientific) for 45-60 min at 37 °C in standard extracellular solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Slides were then washed thrice 5 min in PBS before incubation with Nissl NeuroTrace 530/615 (Invitrogen) at 1:200 (in 3%BSA/PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse (Y2H term reverse: 5’ GGAGACTTGACCAAACCTCTGGCG) primers using Phusion High-Fidelity PCR Kit from Thermo Scientific, with a standard PCR program.
-
bioRxiv - Molecular Biology 2020Quote: ... For qPCR 5–20 ng cDNA was mixed with the Fast SYBR Green Master mix (Applied Biosystems) and amplified with a Light-cycler (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... female) were grown at 37°C and 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM, Life Technologies) supplemented with 10% fetal bovine serum (EUROBIO) ...