Labshake search
Citations for Thermo Fisher :
7251 - 7300 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... Single-stranded cDNA was synthesized from 500 ng RNA using random hexamer primers (Invitrogen, Waltham, USA). qRT-PCR was performed using the Applied Biosystems ViiA 7 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... A first cDNA strand was synthesized with random primers and SuperScript IV Reverse Transcriptase (Life Technologies) and the second strand was then synthesized ...
-
bioRxiv - Immunology 2019Quote: ... Relative gene expression was determined using gene-specific primers and SYBR Green Master Mix (Life Technologies) on a StepOne RT-PCR System (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2019Quote: ... salina CCMP537 genomes using primers listed in Figure S16 and inserted into pENTR-D-Topo (Invitrogen). The promoters were transferred into luciferase reporter destination vectors by an LR clonase reaction (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... The TaqMan primers/probes for all the other genes were purchased from Applied Biosystems (ThermoFisher Scientific).
-
bioRxiv - Genomics 2019Quote: ... 0.5 μM of Ad2.x indexing primer and 0.6x SYBR Green I (Thermo Fisher Scientific #S7585) using 72°C for 5 minutes ...
-
bioRxiv - Developmental Biology 2019Quote: ... a cDNA library was prepared using M-MLV Reverse Transcriptase with oligo(dT) primer (ThermoFisher Scientific). Intron-spanning amplicons from pigeon PITX1 ...
-
bioRxiv - Genetics 2021Quote: ... and the required target locus primers and MGB-NFQ probes (Applied Biosystems; see Supplementary Table 2). Three tubes were set up for each source DNA time point ...
-
bioRxiv - Genomics 2021Quote: ... Primers were prepared based on the sequence of a fso:g9516 and synthesized by Invitrogen (Massachusetts, USA) (Table 1) ...
-
bioRxiv - Biochemistry 2021Quote: ... rRNA was annealed with radioactively labeled primer before reverse transcription with SuperScript III (Thermo Fisher Scientific) at 50°C for 10min ...
-
bioRxiv - Molecular Biology 2021Quote: ... with one primer containing a biotin residue for linkage to magnetic beads (Invitrogen MyOne Strep Dynabeads). Immobilized templates were incubated with yeast nuclear extracts ...
-
bioRxiv - Bioengineering 2021Quote: ... pET15b-CDA5 was amplified using primers 3 and 4 and added to the BsiW1 (Thermo Fisher) site of pSLIK using InFusion (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutations at S18 were introduced using partially overlapping primers with Phusion Flash polymerase (Thermo Fisher Scientific); all clones were sequence-verified ...
-
bioRxiv - Microbiology 2020Quote: ... and Taqman primers and probe targeting HCoV-NL63 (Assay ID: Vi06439673_s1) were ordered from Thermo Scientific. Taqman Gene Expression Assays (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... and primer prJ for (CGA)4-mRNA) were used and Maxima H Minus reverse transcriptase (ThermoFisher) was used to synthesize a single-stranded DNA toward the 5’-end of the RNA ...
-
bioRxiv - Microbiology 2021Quote: ... The reverse transcription reaction was performed with random primers using SuperScript® III reverse transcriptase (Invitrogen).
-
bioRxiv - Plant Biology 2021Quote: ... in which the BBX22 CDS was inserted after cloning into pDONR221 (primers BBX22_attB1_Fw and BBX22_attB2_Rv, Table S1) using Gateway technology (ThermoFisher). bbx21-3D was identified in a forward genetic screen based on hypocotyl length under UV-B of an EMS mutagenized Col-0 population (Podolec et al. ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesized using SuperScript III First-Strand Synthesis kit with oligo(dT) primers (Invitrogen, #18080051).
-
bioRxiv - Neuroscience 2020Quote: ... total RNA using oligo(dT) primers and the SuperScript III First-Strand Synthesis System (Life Technologies). Quantitative RT-PCR (qRT ...
-
bioRxiv - Molecular Biology 2020Quote: The cDNA was synthesized by random primers using High Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific). Two µg of the extracted RNA were used per reaction ...
-
bioRxiv - Microbiology 2020Quote: ... and then amplified by using specific primers provided in the TaqMan Advanced miRNA Assays (Thermo Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The 10 μl of fragmented RNA was added to 0.5 μl of Random primers (Invitrogen, #48190011), 0.5 μl of Oligo d(T ...
-
bioRxiv - Cell Biology 2021Quote: ... employing the Ion AmpliSeq SARS-CoV-2 RNA custom primers panel (ID: 05280253, Thermo Fisher Scientific). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: Reverse transcription reactions were carried out by first mixing 1 µL random primers (Invitrogen Cat. #48190011), 500 ng RNA and ddH2 O up to 10 µL ...
-
bioRxiv - Biochemistry 2022Quote: DNA templates and primers labeled at the 5’-terminus by CY5 dye were synthesized from Invitrogen. 200μL of Labeled primer(100μM ...
-
bioRxiv - Genetics 2022Quote: ... Primers were purchased from Integrated DNA Technologies (Coralville, IA) and TaqMan MGB probes from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biochemistry 2022Quote: ... Sequencing ladders were generated using the Thermo Sequenase Dye Primer Manual Cycle Sequencing Kit (Applied Biosystems). Gels were scanned within optically clear glass plates (VWR ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 ng of total RNA was used for Taqman reactions using primer probes from Thermo Fisher: Hs00242739_m1 (LTB) ...
-
bioRxiv - Cell Biology 2022Quote: ... then reverse transcribed with random primers using the High Capacity sDNA Reverse Transcription Kit (Life Technologies) as described by the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: ... anchored oligo(dT) 15 VN primers and MMuLV reverse transcriptase according to the manufacturer’s description (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... NR-52285) using the primers in Table II and cloned into pCDNA-V5/His TOPO (Invitrogen). We introduced a FLAG tag to JUNV GP by PCR amplifying it from a previously described expression plasmid (58 ...
-
bioRxiv - Microbiology 2020Quote: ... and then reverse transcribed with poly T primers using High Capacity cDNA Reverse Transcription Kit (Invitrogen). Real-Time PCR was carried out using by Taqman assays with pre-designed gene-specific primer/probe set (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... were amplified by PCR using the primers FLO11_TOPO_f and FLO11_TOPO_r (Table S6) and ligated into pYES2.1 TOPO TA vector (ThermoFisher Scientific) between GAL1 promoter and CYC1 terminator according to the manufacture’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... cDNA was synthesized from 1.5 μg total RNA using oilgodT primers and RevertAid Reverse Transcriptase (Thermofisher). Quantitative reverse transcriptase PCR (qRT-PCR ...
-
bioRxiv - Biophysics 2021Quote: ... digoxigenin- and biotin-labeled sense and anti-sense primers (Integrated DNA Technologies, Coralville, IA, or Invitrogen, Life Technologies ...
-
bioRxiv - Immunology 2022Quote: ... Samples were then pooled and primers were removed using GeneJET NGS cleanup kit (Fisher Scientific, FERK0852). DNA concentrations were measured by a Qubit fluorescent reader and 300 pg of the pooled sample was then sequenced using an Ion Torrent Sequencing system following the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... the PCR products obtained with 2 primers (AV48_SMCHD1_gPCR_F: 5’-AGGAGCGCGTTTGAATCGG-3’, AV47_SMCHD1_gPCR_R 5’-CTTCGCGTACCTGACACACAC-3’) were TOPO-cloned (Thermo Fisher, #450071) and sent for sequencing.
-
bioRxiv - Immunology 2019Quote: ... Oligonucleotide primers and a dual labelled probe for DENV 1,2,3,4 serotypes were used (Life technologies, USA) based on published sequences ...
-
bioRxiv - Cancer Biology 2019Quote: ... incubated with 2 pmol of PE_1248_BLOCK (IDT) primer and 2U of RNase H (18021-014, Invitrogen) or mock enzyme treatment at 37°C for 20 min followed by heat inactivation at 65°C for 10 min ...
-
bioRxiv - Developmental Biology 2020Quote: 500 ng of total RNA were reverse transcribed with random primers (48190–011, Thermo Fisher Scientific), oligo(dT ...
-
bioRxiv - Immunology 2020Quote: ... Oligonucleotide primers and a dual labeled probe for DENV 1,2,3,4 serotypes were used (Life technologies, India) based on published sequences [19].
-
bioRxiv - Cell Biology 2019Quote: ... cDNA was then synthesized using random primers and Superscript III reverse transcriptase (Life Technologies, Carlsbad, CA). For real-time PCR ...
-
bioRxiv - Microbiology 2019Quote: ... then reverse-transcribed using oligo-dT primer and SuperScript III reverse transcriptase (ThermoFisher, Carlsbad, CA, USA) at 50 °C for 60 min ...
-
bioRxiv - Genetics 2020Quote: ... MSH6 and GUSB (Hs99999908_m1) or 1.8 µM primer mix (IDT) and 250 nM probes (ThermoFisher Scientific) for GAPDH and UBC ...
-
bioRxiv - Genetics 2020Quote: ... 1μl of sample cDNA and 0.63μl of Probe+Primers mix (TaqMan Gene Expression Assays, Thermo Fisher). The Viia7 software was used to extract raw data ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription was performed with random primers using the SuperScript II First-Strand Synthesis System (Invitrogen). qRT-PCR reactions used SYBR Green Master Mix with the Real-Time PCR Detection systems (Bio-Rad) ...
-
bioRxiv - Microbiology 2020Quote: ... using the primers AsnS_F (CGGGCCGCTTCGTTAAAAA) and AsnS_R (TGGAATTCCTCAGACTTGCCA) with a Veriti Thermal Cycler (Applied BioSystems, USA). PCR products were purified using the NucleoSpin Gel and PCR Cleanup kit (Macherey-Nagel ...
-
bioRxiv - Immunology 2021Quote: ... RNA and primers were mixed with the TaqPath 1-step RTqPCR master mix (Applied Biosystems, A15299). A standard curve for Ct values and genome copy numbers was obtained using pET21b+ plasmid with the N-gene inserts ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting pellet was resuspended in water and reverse transcribed with random primers (Maxima H, ThermoFisher). mRNA was normalized to luciferase spike to control for recovery ...
-
bioRxiv - Biochemistry 2021Quote: ... The genes were synthesized by IDT (Coralville, IA) and primers were synthesized by Life Technologies (USA). DNA sequencing were performed at Genewiz (San Diego ...