Labshake search
Citations for Thermo Fisher :
7251 - 7300 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The total RNA from mouse liver or Hepa1-6 cells was extracted using ISOGEN (Nippon Gene) and reverse-transcribed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... An equal volume of RNA solution from both fractions was used to generate cDNA separately using High-Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems, REF4368813) according to the manufacturers’ instruction ...
-
bioRxiv - Cancer Biology 2023Quote: ... Eluted phosphopeptide samples from both enrichments were pooled and fractionated into 14 fractions by increasing ACN concentration from 7 % to 50 % using the Pierce High pH Reversed-Phase Peptide Fractionation Kit (Thermo Fisher Scientific). Peptide separations of the whole proteome sample were performed using basic reversed-phase chromatography (bRP-LC ...
-
bioRxiv - Cell Biology 2023Quote: ... Synthesis of cDNA was done with 2 µg of total RNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368814). Quantitative PCR (qPCR ...
-
bioRxiv - Biochemistry 2023Quote: ... cDNA synthesis of equal amounts of RNA from each sample was achieved using the Applied Biosystems High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher #4368814). SYBR Green ER SuperMix (Thermo Fisher #11762500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was synthesized using 2 µg total RNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Real-time PCR was performed using a StepOnePlus system (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg of RNA was input into each 20 µl cDNA reaction using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems #4368814) under cycling conditions 25°C 10 mins ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 µg of total RNA was reverse transcribed to cDNA using a High-Capacity cDNA Reverse Transcription Kit (Thermo Scientific, Cat 4368814). qPCR was performed in duplicates for each biological replicate in a 20 µl reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA isolated from gastric tissue samples (2μg/sample) was reverse transcribed into cDNA using High Capacity cDNA Reverse Transcription Kit (Thermo Fisher, Waltham MA). 1μl of cDNA was used per well in a total of 10μl reaction mix for amplification using the StepOne Real Time PCR (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Reverse transcription of the resulting RNA was performed using High-capacity RNA-to-cDNA kit (Applied Biosystem, Thermo Fisher Scientific, MA, USA) and the expression of specific gene was analysed using TB Green® Premix Ex Taq™ II (TaKaRa Bio Inc. ...
-
bioRxiv - Plant Biology 2023Quote: ... The HKT1;1 coding sequence construct was generated by PCR with the total cDNA preparation as template which was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) with oligo-dT as the primer ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: The gene fragment containing the residue 230 of STING was amplified by PCR using Phusion high-fidelity PCR kit (ThermoFisher Scientific, USA). The PCR reaction was set up using template genomic DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... concentrated using vacuum centrifugation and separated into eight fractions using Pierce™ High pH Reversed-Phase Peptide Fractionation Kit (84868, Thermo Scientific) according to the manufacturer’s instructions for TMT-labelled peptides ...
-
bioRxiv - Microbiology 2023Quote: ... and up to 2 µg of RNA was used per 20 µl cDNA synthesis reaction (High-Capacity cDNA Reverse Transcription Kit, Thermo Fisher Scientific). 10 µl RT-qPCR reactions consisting of 2 µl cDNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA concentrations were measured using Nanodrop One and 0.25ug of RNA for gene analysis was used for reverse transcription using the High-Capacity RNA-to-cDNA Kit (Applied Biosystems, 4368814) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... carried out at 30 °C according to protocol or the TranscriptAid T7 High Yield Transcription Kit (Thermo Fisher Scientific, Waltham, MA, USA) following the respective protocol provided by the manufacturers for in vitro RNA transcripts with or without a cap ...
-
bioRxiv - Cell Biology 2023Quote: ... Phosphopeptide enrichment was performed using TiO2 spin tips from the High-SelectTM TiO2 Phosphopeptide Enrichment Kit following the manufacturer’s protocol (Thermo Fisher, Waltham, USA). After enrichment ...
-
bioRxiv - Biochemistry 2023Quote: ... Mixed peptide samples were prepared from 4 μL of each sample and separated using a high pH reversed-phase peptide separation kit (Thermo Fisher Scientific) according to the instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Mixed peptide samples were prepared by 9ul per sample and separated using the High pH Reversed-Phase Peptide Isolation Kit (Thermo Fisher Scientific) as directed ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the in-house MagPrep silica beads method was used to synthesize cDNA using the High Capacity cDNA Reverse Transcription (RT) Kit (Thermo Fisher Scientific) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was isolated from cell lysates and first-strand cDNA was generated using High-Capacity cDNA Reverse Transcription kits (Applied Biosystems, USA), according to the manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... These males were then sacrificed for genomic DNA extraction and mutations in Rtnl1 locus were analysed by PCR using Surveyor Mutation Detection Kit with Phusion High-Fidelity Polymerase and GGCAAGGTAAACAGCGAGAC (Rtnl1-1A) and TGTGTATGGTGGACAAAAGCA (Rtnl1-1B) primers (WT amplicon, 629 bp; Thermo Fisher Scientific) (Supplementary Fig ...
-
bioRxiv - Cell Biology 2023Quote: ... Those peptides were divided into several fractions using the Pierce High pH Reversed-Phase Peptide Fractionation kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA was then converted to cDNA using high-capacity cDNA Reverse Transcription Kit (Cat # 4368813, Applied Biosystems™, Foster City, CA) and gene expression was assessed by TaqMan qRT-PCR with targeted TaqMan assay probes ...
-
bioRxiv - Cancer Biology 2023Quote: For the evaluation of lncRNA polyadenylation total RNA was reverse transcribed with the High-Capacity complementary DNA Reverse Transcription Kit (Thermo Fisher Scientific) using either random hexamers or Oligo(dT)12-18 Primer (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 500 ng of RNA was reverse transcribed to cDNA by using a High-Capacity RNA-to-cDNA Kit (Applied Biosystems, CAT: 4388950). The PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of RNA was then used to reverse transcribe cDNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368813) following ...
-
bioRxiv - Immunology 2023Quote: ... The combined flowthrough and washes were dried down in a speed vac to completion for subsequent bench-top fractionation of non-phospho peptides by alkaline reversed phase chromatography (PierceTM High pH Reversed Phase Peptide Fractionation Kit, Thermo Scientific #84868) with a modified elution scheme as described in81 and MS analysis.
-
bioRxiv - Biochemistry 2023Quote: ... Mixed peptide samples were prepared from 4 μL of each sample and separated using a high pH reversed-phase peptide separation kit (Thermo Fisher Scientific) according to the instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription of RNA (800-1000 ng) to generate cDNA was performed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... synthesized with Applied Biosystems High-Capacity cDNA Archive Kit was used as a template for relative quantitative PCR using ABI TaqMan chemistry (Applied Biosystems, #4368814). mRNA expression was quantified using Hs00240906_m1 (human SNCA) ...
-
bioRxiv - Cell Biology 2023Quote: ... The enriched phosphopeptides were dried down and fractionated according to manufacturer’s instructions using High pH reversed-phase peptide fractionation kit (Thermo Fisher Scientific, 84868) for a final 6 fractions and subjected to C18 StageTip desalting prior to MS analysis.
-
bioRxiv - Physiology 2024Quote: ... 1000 ng of total RNA was converted to cDNA using the “High-Capacity cDNA Reverse Transcription Kit” (Thermo Fisher Scientific, Ref# 4368814). Sample cDNA was diluted 1:10 before input for real-time Q-PCR reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 μg of each pooled sample was digested in-solution as described above and fractionated by Pierce™ High pH Reversed-Phase Peptide Fractionation Kit (ThermoFisher Scientific) according to manufacturer recommendations ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA concentrations were measured using a spectrophotometer (Nanodrop, xxx) and RNA were used for reverse transcription (High-Capacity cDNA Reverse Transcription Kit, Thermo Fisher #4368813). Abundance of genes of interest was quantified using the SYBR Green-based quantification method (FastStart Universal SYBR Green Mastermix ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA synthesis from the RNA samples was performed using the High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Applied Biosystems #4374966) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... of samples were pooled and separated into 6 fractions by off-line basic reversed-phase (bRP) using the Pierce High pH Reversed-Phase Peptide Fractionation Kit (Thermo Fisher Scientific). The fractions were collected in 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... Ten microliter of each extracted RNA was used to synthesise cDNA using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368813). RT-qPCR was performed using TaqMan Universal Master Mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: Transfection efficiency was determined with reverse transcription of 500ng of RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™ #4368814). RT-qPCR was then performed with Taqman® technology using the following probes ...
-
bioRxiv - Molecular Biology 2023Quote: Peptides in the compiled sample were fractionated (8 fractions) using the Pierce High pH Reversed-Phase Peptide Fractionation Kit (Cat: 84868; Thermo Fisher Scientific). Prior to liquid chromatography–mass spectrometry (LC-MS ...
-
bioRxiv - Biochemistry 2023Quote: ... Dried samples were redissolved with 300 μL of 0.1% TFA in H2O and further fractionated using high-pH reversed-phase peptide fractionation kits (ThermoFisher, P/N 84868) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... desalted peptides were subject to a phosphopeptide enrichment (“mini-phos”) using the High-Select Fe-NTA Phosphopeptide Enrichment Kit (Cat# A32992, Thermo Fisher Scientific) following manufactureŕs instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6 μl of RNA from each fraction was converted to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher #4368814). The cDNA was diluted 10 times before qPCR analysis ...
-
bioRxiv - Microbiology 2023Quote: ... Two micrograms of total RNA from each sample were converted to cDNA using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific). Quantitative PCR (qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... The TMT labeled peptide pools were separated into eight fractions with the Pierce™ High pH Reversed-Phase Peptide Fractionation Kit (ThermoFisher Scientific), evaporated ...
-
bioRxiv - Plant Biology 2023Quote: ... two micrograms of RNA was used for cDNA synthesis as per manufacturer’s instructions (High-Capacity cDNA Reverse Transcription Kit was from Applied biosystems, Waltham, USA). The real-time primers (Table S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... and about 1.8 μg of total RNA was reverse transcribed using a High Capacity RNA to cDNA kit (Applied Biosystems; Thermofisher Scientific). Additional samples in which RNA was not reverse transcribed were included as controls and indicated effective genomic DNA removal.
-
bioRxiv - Physiology 2024Quote: ... Then the pool was fractionated into 8 fractions using the High pH fractionation Thermo-Kit (Cat. # 84868; Thermo Fisher Scientific, Darmstadt, Germany) method ...
-
bioRxiv - Immunology 2024Quote: ... RNA from each sample was reverse-transcribed to cDNA with a High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, cat. #74136). Real-Time PCR was performed on each sample using an Applied Biosystems QuantStudio 3 instrument with PowerUP SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... 2000 ng RNA was reverse transcribed into cDNA using high-capacity RNA-to-cDNA kit (Applied biosystems™, Thermo Fisher, Ref: 4387406) following the manufacturer protocol.