Labshake search
Citations for Thermo Fisher :
7201 - 7250 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Reverse transcription for up to 2 µg of total RNA was performed using the High-Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific). qPCR was performed in a ViiA 7 Real-Time PCR machine (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Fifty ng of RNA was then reverse transcribed into cDNA using a High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (4374966; Thermo Fisher Scientific) and following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative PCR was performed on reverse transcribed RNAs (High Capacity Reverse cDNA Transcription kit with the included set of random primers, Applied Biosystems, ThermoFisher, France). Based on the output of the GeNorm program ...
-
bioRxiv - Cancer Biology 2022Quote: ... First-strand complementary DNA (cDNA) was generated from 1 μg of total RNA with the High-Capacity RNA-to-cDNA™ Kit (ThermoFisher Scientific). RT-qPCR was performed using TaqMan® Assays in 10 μL reaction mixtures ...
-
bioRxiv - Biochemistry 2022Quote: ... Mixed peptide samples were prepared from 9 μL of each sample and separated using a high pH reversed-phase peptide separation kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... First strand cDNA synthesis was carried out using the RT Random Primers of the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems™) and treated with RNase Inhibitor (Applied Biosystems™ ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 106 cells were isolated by flow cytometry and 1µg of purified RNA was reverse transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific 4368813). A standard curve was used to determine the mean quantity value of target transcripts between conditions and across three technical replicates per sample ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA concentrations measured by spectrophotometer and 500 ng RNA used for reverse transcription (High-Capacity cDNA Reverse Transcription Kit, Thermo Fisher #4368813). Abundance of Adcy3-at ...
-
bioRxiv - Immunology 2022Quote: ... RNA was quantified at 260nm using a Nanodrop 2000 spectrophotometer and 300ug were used to create a cDNA library using the High-Capacity RNA-to-cDNA™ Kit (Cat. No. 4387406, Applied Biosystems) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... according to manufacturer’s instructions and 200 ng RNA was used to make cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems #4368814). The cDNA was diluted 1:5 and a qPCR reaction mixture composed of the diluted cDNA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... RNA pellet was washed three times with 75% ethanol and heating was used to evaporate remaining ethanol as well as to aid solubilization of the pellet in water.28 cDNA was synthesized from ~400 ng of RNA with High-Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Thermo Fisher Scientific). For qPCR reactions ...
-
bioRxiv - Plant Biology 2022Quote: ... 1-µg of total RNA for each sample was subjected to cDNA synthesis with high-capacity cDNA reverse transcription kit (Applied Biosystems, USA), according to the instructions provided in the manual ...
-
bioRxiv - Plant Biology 2022Quote: ... 1-µg of total RNA for each sample was subjected to cDNA synthesis with high-capacity cDNA reverse transcription kit (Applied Biosystems, USA). Gene-specific primers for qRT-PCR were designed using PRIMER EXPRESS version 2.0 (PE Applied Biosystems ...
-
bioRxiv - Physiology 2022Quote: ... DNAse-treated total RNA (1 µg) was used to generate cDNA using a High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific). Gene expression was measured using gene-specific primers (listed below) ...
-
bioRxiv - Neuroscience 2022Quote: ... RVLM-containing tissue punches were reverse transcribed to cDNA using a High-capacity RNA to cDNATM kit (Applied BiosystemsTM, Thermo Fisher Scientific). The reverse transcription reaction was performed using a thermal cycler (T100 ...
-
bioRxiv - Plant Biology 2023Quote: The first strand cDNAs were synthesized from all DNA-free RNA samples with a high capacity cDNA reverse transcription kit (Applied Biosystems, USA) by following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: First strand cDNA was synthesized from 200 ng of total RNA from each sample using the High-Capacity cDNA Archive kit (Thermo Fisher Scientific). The relative expression levels of transcripts encoding the different FHF isoforms ...
-
bioRxiv - Plant Biology 2023Quote: ... The first strand cDNA was synthesized using the DNA-free RNA samples as template and the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA). The reverse transcription steps followed the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2024Quote: ... Dried samples were redissolved with 300 μL of 0.1% TFA in H2O and further fractionated using high-pH reversed-phase peptide fractionation kits (ThermoFisher, P/N 84868) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from the DRGs was reverse transcribed using a High-Capacity RNA-to-cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was synthesized from 500 ng total RNA with the High-capacity cDNA reverse Transcription Kit (Applied Biosystems™, Waltham, Massachusetts, USA) in a reaction volume of 20 µl following manufacturers recommendations ...
-
bioRxiv - Immunology 2022Quote: ... and cDNA synthesis was performed from 2 µg of total RNA using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher, Waltham, Massachusetts), both according to manufacturers’ protocols ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Single-stranded cDNA was synthesized from 1 μg RNA in a 20 μl final volume using the High-Capacity cDNA Reverse Transcription Kit with RNase inhibitor (Thermo Fisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from 1 μg of total RNA using oligodT and a High-fidelity cDNA synthesis kit (Thermo Scientific, Vilnius, Lithuania). The primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Microbiology 2022Quote: ... Synthesis of cDNA from 1000ng (10μl) RNA was performed using a High Capacity cDNA Reverse Transcription Kit from Applied BioSystems (cat. 4368814). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... 2-5μg of RNA was reverse transcribed into cDNA at 37°C for 2 hours using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). cDNA was stored at -20°C and real-time PCR was performed using Taqman primers and probes for Il10 ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was generated from 150 ng of RNA in a 20 μl reaction using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, #4368814). qPCR was performed using TaqMan Fast Universal PCR Master Mix (ThermoFisher ...
-
bioRxiv - Bioengineering 2024Quote: ... cDNA was synthesized from 1 µg of RNA by following the protocol of the high-capacity cDNA reverse transcription kit (Applied Biosystems; 4368814). Real time PCR was performed using PowerTrackTM SYBR green master mix (Applied Biosystems ...
-
bioRxiv - Bioengineering 2024Quote: ... cDNA was synthesized from 1 µg of RNA by following the protocol of the high-capacity cDNA reverse transcription kit (Applied Biosystems; 4368814). Real time PCR was performed using PowerTrackTM SYBR green master mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNAs (2 μg) were then reverse-transcribed into first strand cDNAs using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 ng of RNA from each sample was used for cDNA synthesis using High-capacity RNA-to-cDNA kit (#4387406, Thermo Fisher Scientific). qPCR mixture was prepared using PowerUp™ SYBR™ Green Master Mix for qPCR (#A25741 ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was prepared with 2 μg of the treated RNA in 20 μL total volume of reaction mix using a high-capacity cDNA reverse transcription kit from Applied Biosystems (4368814). The cDNA was further diluted 1:10 to obtain a final concentration of 10 ng/μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μg of total RNA was reverse-transcribed using a high-capacity cDNA archive kit from Applied Biosystems (Foster City, CA, USA) following the supplier’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Pooled TMT-labelled peptides were cleaned and fractionated using the Pierce High pH Reversed-Phase Peptide Fractionation Kit (Thermo Fisher Scientific, 84868) according to manufacturer’s instruction for TMT experiments ...
-
Identification of echinacoside as a tobramycin potentiator against Pseudomonas aeruginosa aggregatesbioRxiv - Microbiology 2024Quote: Freshly extracted RNA (500 ng per 20µL reaction) was transcribed into cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher). Such cDNA samples were applied as templates for RT-qPCR using 2× GoTaq® qPCR Master Mix (Promega) ...
-
bioRxiv - Microbiology 2024Quote: ... cDNAs were generated using 125 ng RNA (High-Capacity cDNA Reverse Transcription Kit using 250 nM oligodT instead of the provided random primers, ThermoFisher Scientific, 4368813) and analysed by quantitative (q)PCR ...
-
bioRxiv - Microbiology 2024Quote: ... The CEP cDNA library was prepared from CEP total RNA preparation using the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher, cat# 4368814) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and 100 ng of RNA from each sample was converted to cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368813) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was reverse transcribed into cDNA according to manufacturer’s instructions using the High-Capacity Reverse Transcription Kit (Thermo Fisher Scientific, cat # 4368814). qPCR was performed using iTaq Universal SYBR Green Supermix (Biorad ...
-
bioRxiv - Cell Biology 2023Quote: Any contaminating DNA was removed from the RNA extract using the high efficiency TURBO DNA-free Kit (ThermoFisher Scientific; cat. no., AM1907), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Aliquots of 1 µg RNA were reverse-transcribed with the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). For relative quantification of mRNA ...
-
bioRxiv - Biochemistry 2023Quote: ... mutagenic primers were designed (see below) and the mutagenesis was done using either the Phusion High-Fidelity PCR Kit (ThermoFisher Scientific, USA) or the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg of RNA was used for reverse transcription using the High Capacity RNA-to-cDNA kit (Life Technologies, cat. no. 4387406), and cDNA samples were diluted with nuclease-free water at a 1:2 ratio ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was reverse transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems 4368814, Applied Biosystems, Waltham, Massachusetts, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Equal amounts of RNA (0.5–1 μg) were reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific #4368813) with the random primers provided ...
-
bioRxiv - Cell Biology 2023Quote: ... before 800 ng total RNA was reverse transcribed using random primers and the high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific). To measure relative mRNA levels of target genes ...
-
bioRxiv - Microbiology 2022Quote: ... 5’-/FAM/TCAAGGAACAACATTGCCAA/TAMRA/-3’) were examined by real-time RT-PCR using High Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368813) and AriaMX (Agilent ...
-
bioRxiv - Bioengineering 2023Quote: ... One μg of RNA was converted into cDNA using the high-capacity cDNA reverse transcription kit according to the manufacturer instructions (Applied Biosystems, 4368814). qPCR was performed with PowerTrack SYBR green master mix (A46109 ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was generated from 500 ng of RNA per sample using the High-Capacity cDNA Reverse Transcription Kit (4368814, Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... and RNA (2μg) was reverse transcribed to cDNA with the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). Real-time PCR was performed in a QuantStudio 12K Flex Real Time PCR System (ThermoFisher Scientific ...