Labshake search
Citations for Thermo Fisher :
7151 - 7200 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: Phosphopeptides were enriched from the remaining 9/10th of the cleaned FASP eluate after complete solvent evaporation (SpeedVac concentrator) using High-Select™ TiO2 Phosphopeptide Enrichment Kit (Thermo Fisher Scientific ...
-
REV-ERBα mediates complement expression and circadian regulation of microglial synaptic phagocytosisbioRxiv - Neuroscience 2020Quote: ... RNA concentrations were then measured using the Nanodrop spectrophotometer and cDNA was made using a high capacity RNA-cDNA reverse transcription kit (Applied Biosystems/LifeTechnologies) with 1μg RNA used per 20μL reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA fragments were synthesized using 1 μg of PCR-generated fragments using the TranscriptAid T7 High Yield Transcription Kit (Thermo Fisher Scientific). Upon DNase I treatment for 30 min (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2000 ng of RNA was used to prepare cDNA with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA, Cat. No. 4368814). cDNA was diluted at 1:10 and 4 µl of template cDNA was mixed with AMPLIFY ME SG Universal Mix (Blirt ...
-
bioRxiv - Neuroscience 2020Quote: ... 500-1000 ng RNA per sample was reverse-transcribed using Applied Biosystems high-capacity reverse transcription kit (Applied Biosystems, Foster City, CA). Quantitative RT-PCR was performed using Taqman probes commercially available from Applied Biosystems targeting GAPDH (Mm99999915_g1 ...
-
bioRxiv - Plant Biology 2021Quote: cDNA was synthesized from 1 µg of purified RNA of each samples using cDNA high yield synthesis kit (SuperScript IV VILO, Thermo Fisher Scientific). Quantitative PCR was performed with following primers and SYBR green kit (PowerSYBP Green PCR Master Mix ...
-
bioRxiv - Neuroscience 2021Quote: ... Equal amounts of RNA from each sample were reverse transcribed in 20 μl to produce cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) following the manufacturer’s recommendation ...
-
bioRxiv - Cancer Biology 2020Quote: ... RT-PCR was carried out with 1 μg RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster city, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1µg of total RNA was reverse-transcribed into complementary DNA (cDNA) using the high-capacity cDNA reverse transcription kit (Applied Biosystems, 4368814). The resulting cDNA were amplified using specific primers for the genes of interest ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA samples were diluted to 200 ng/μL and 1 μg of RNA was converted into cDNA using a High-Capacity cDNA Reverse Transcription Kit according to the manufacturer’s instructions (ThermoFisher, Cat no 4368814). cDNA was then diluted 1:5 in ddH2O for downstream analysis.
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized from 500 ng of total RNA using a High-Capacity RNA-to-cDNA™ Kit (4388950, Thermo Fisher Scientific). PrimeTime Std® qPCR Assays (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated for 72 h and then collected in Trizol for analysis of M1 and M2 markers using RT-qPCR as previously described except the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) was used according to manufacturer’s instructions for cDNA synthesis ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The high-quality mRNA was isolated with a FastTrack MAG Maxi mRNA Isolation Kit (Thermo Fisher Scientific, K1580-02, Waltham, MA, USA). The RNA extraction procedure was performed according to the following instructions ...
-
bioRxiv - Cancer Biology 2022Quote: High-quality RNA was extracted from tumour gastric mucosa and healthy mucosa using the PureLink™ RNA Mini Kit (Thermo Fisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Residual endotoxin in the BiFab preparation was removed using an endotoxin removal kit (Pierce: High Capacity Endotoxin Removal Spin Column; Thermo Scientific, UK). Final endotoxin reading was <0.2 EU/mg at a final concentration of 1.02 mg/ml ...
-
bioRxiv - Immunology 2019Quote: ... Reverse transcription of 1 µg RNA into cDNA was done using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, CA, USA). RT-PCR was performed on the LightCycler® 480 instrument using the LightCycler® 480 SYBR Green I Master mix (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2020Quote: ... One microgram of total RNA was reverse-transcribed into cDNA using High Capacity cDNA Reverse Transcription Kit (Applied biosystems, Foster City, California). Gene expression was analyzed with SYBR Select Master Mix (Life Technologies ...
-
bioRxiv - Plant Biology 2019Quote: ... 500 ng of RNA was subjected to reverse transcription with random primers using High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... 2 μg of total RNA was used to synthesize the first-strand cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... cDNA was synthesized from 1 μg total RNA in 20 μl reactions using High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). After synthesis ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... One μg total RNA from each sample was then reverse-transcribed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, 4368814) and the resulting cDNA was diluted 1:5 with nuclease-free ...
-
bioRxiv - Cancer Biology 2019Quote: ... on 1 μg of total RNA for each condition using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Saint Aubin, France) with random hexamer pdN6 primers.
-
bioRxiv - Bioengineering 2020Quote: ... RNA was quantified using spectrophotometry and 1 μg of RNA of each sample was reverse-transcribed using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific), following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA concentration was assessed using Nanodrop and cDNA was synthesized using high-capacity cDNA reverse transcription kit (Applied Biosystems, Cat. No. 4368814). Quantitative real-time PCR was performed on a 7,500 Fast Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... were plated for serological screening and high-throughput nucleic acid extraction using the MagMAX™ mirVANA and CORE pathogen kits (ThermoFisher, Australia).
-
bioRxiv - Genetics 2020Quote: ... 1-2 ug total RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, #4368814). Real-time PCR was performed using specific primers for ACTN2 (GCTGAAGAAATTGTTGATGG ...
-
bioRxiv - Immunology 2020Quote: ... The cDNA was synthesized using 1μg of total RNA using high capacity cDNA reverse transcription kit (Applied Biosystems, Foster city, CA, USA). Real-time PCR was performed on 7500 Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA (0.5 μg) was then used for cDNA synthesis using a high capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA). qPCR was performed using a Power SYBR Green PCR master mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was generated from 1 μg of RNA using random primers according to the protocol from the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher scientific) with RNase Inhibitor.
-
bioRxiv - Genetics 2020Quote: ... Complementary DNA (cDNA) was synthesized from total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) following the manufacturers protocol ...
-
bioRxiv - Genomics 2021Quote: ... First-strand cDNA was synthesised from 1 μg of mRNA for each sample using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814) with custom primers (Supp Table 4).
-
bioRxiv - Immunology 2021Quote: ... Single-strand cDNA was synthesized from 500 ng RNA per sample using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) following the standard protocol ...
-
bioRxiv - Physiology 2021Quote: ... Total RNA (1 μg) was reverse transcribed into cDNAs using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, São Paulo, Brazil) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... About 1.4µg of DNase-treated total RNA was set aside for reverse transcription against (-)RT controls using the high capacity cDNA reverse transcription kit (Thermo Fisher™). Codon optimized RBD gene expression was assessed against a cells only control using qPCR and normalized to human 18S rRNA gene levels by the delta delta Ct method (Livak and Schmittgen ...
-
bioRxiv - Physiology 2020Quote: ... DNAse-treated total RNA (1 µg) was used to generate cDNA using a High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific). Gene expression was measured using gene-specific primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... Flow-through fraction was dried and used for second enrichment step using High-Select™ Fe-NTA Phosphopeptide Enrichment Kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: cDNA synthesis with RNA samples was performed by reverse transcription using random primers (High-Capacity cDNA Reverse Transcription Kit, Thermo Fisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The concentration of RNA was measured using NanoDrop1000 followed by reverse transcribed the RNA to cDNA using High capacity RNA-to-cDNA Kit (Thermo Fisher, 4387406). Taqman probes (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription of mRNA (up to 2 μg/reaction) was performed using the Applied Biosystems High-Capacity RNA-to-cDNA kit (Thermo Fisher Scientific). qRT-PCR (20 ng cDNA/reaction ...
-
bioRxiv - Molecular Biology 2021Quote: ... a total of 1 μg of extracted total RNA was used for synthesis of first strand cDNA using a High-capacity RNA-to-cDNA kit (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 250 ng or 500 ng of RNA was reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, 4368813) per manufacturer instructions.
-
bioRxiv - Microbiology 2021Quote: ... The NA gene was amplified from the cDNA and plasmids using gene-specific primers and the Platinum™ Taq DNA Polymerase High Fidelity kit (Invitrogen, USA) and sent for sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... An amount of 2 μg of total RNA was reverse-transcribed into cDNA (High Capacity cDNA Reverse Transcription Kit, Applied Biosystems, USA). The reaction mixture was incubated for 10 minutes at 25 °C ...
-
bioRxiv - Immunology 2021Quote: ... a one-step RT-PCR was performed for 25 cycles using heavy chain BIOMED-2 variable antibody gene-specific primers as previously described 45–47 and the OneStep SuperScript III with Platinum® Taq High Fidelity kit (Invitrogen, 11304011).
-
bioRxiv - Immunology 2020Quote: ... We used the High Capacity RNA-to-cDNA reverse transcription Kit using 1 μg messenger RNA per reaction (Life Technologies, Carlsbad, CA). Quantitative real-time polymerase chain reaction was performed using the ABI Prism 7000 Sequence Detection System (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: RNA was purified from approximately 25,000 of FACS-isolated CD49f high and CD49f neg Treg using the Arcturus PicoPure Isolation Kit (Thermo Fisher Scientific, USA). RNA integrity was confirmed on the Agilent 2100 Bioanalyser using the Total RNA Pico Kit (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μg of total RNA from each sample was converted to cDNA using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368813). Primer pairs used for this study are listed below.
-
bioRxiv - Immunology 2021Quote: ... Total RNA samples (up to 2 µg) were reverse transcribed using the oligo(dT) primer from the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher®). Molecular detection of SARS-CoV-2 was performed with TaqMan™ Gene Expression Assay (Cat ...
-
bioRxiv - Immunology 2021Quote: ... For HepaRG cells: 1 μg of total RNA was reverse transcribed into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, UK). The reaction contained a mixture of 1 μl Reverse Transcriptase ...
-
bioRxiv - Immunology 2021Quote: ... 250 μg of RNA from each sample was then reverse transcribed into cDNA using the High-capacity cDNA Reverse Transcription kit (Applied Biosystems #4368814) according to manufacturer’s instructions ...