Labshake search
Citations for Thermo Fisher :
6951 - 7000 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... high glucose (Thermo Fisher Scientific, Gibco #11965084) with 10% calf serum (Gemini bio-products #100-510 ...
-
bioRxiv - Bioengineering 2021Quote: ... Phusion High Fidelity DNA polymerase (Thermo Scientific) was used ...
-
bioRxiv - Neuroscience 2021Quote: ... high capacity streptavidin agarose (20357, Thermo Scientific) (~ 25 μL packed resin per sample ...
-
bioRxiv - Cancer Biology 2021Quote: ... for PCR (PCR SuperMix High Fidelity, Thermofisher). PCR products were gel extracted and then Sanger sequenced using both 5’- and 3’-end primers to confirm reads from each end of the product ...
-
bioRxiv - Neuroscience 2020Quote: ... in Mφ medium [(DMEM high glucose, Gibco), 10% FBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Pico 17 High speed centrifuge( Thermo Scientific ); Nitrogen evaporator N-EVAP 116 (Organomation).
-
bioRxiv - Plant Biology 2020Quote: ... Phusion High-Fidelity DNA polymerase (ThermoFisher Scientific) was used for subsequent PCR amplification.
-
Panacea: a hyperpromiscuous antitoxin protein domain for the neutralisation of diverse toxin domainsbioRxiv - Microbiology 2021Quote: ... Phusion High-Fidelity DNA Polymerase (Thermo Scientific) was used to amplify the panA mutant (pK223_fwd_CPEC and pK223_rev_CPEC primers ...
-
bioRxiv - Microbiology 2022Quote: ... Phusion High-Fidelity Taq Polymerase (Thermo Scientific) and the pm623 (TGCCGTTGAAACTGGGTTACTTGA ...
-
bioRxiv - Cell Biology 2022Quote: ... high glucose with GlutaMAXTM (Thermo Fisher Scientific), 20% FBS (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... Phusion high-fidelity DNA polymerase (Thermo Scientific) was used for PCR amplification.
-
bioRxiv - Molecular Biology 2022Quote: ... high–glucose Dulbecco’s modified Eagle’s medium (Gibco), supplemented with 10% fetal bovine serum (Sigma 12133C) ...
-
bioRxiv - Microbiology 2022Quote: ... alongside high molecular weight markers (ThermoFisher LC5699). The gel was run at 150 Volts for 60 minutes ...
-
bioRxiv - Genetics 2020Quote: DMEM High Glucose (Gibco™ 11995-065), DMEM low Glucose (Gibco™ 11885-084) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and cultured in high glucose DMEM (Gibco) supplemented with 10% FBS (Sigma ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Phusion High-Fidelity DNA Polymerase (ThermoFisher Scientific) was routinely used for PCR amplification ...
-
bioRxiv - Biochemistry 2021Quote: ... high glucose (Thermo Fisher Scientific, Gibco #11965084) with 10% calf serum (Gemini bio-products #100-510 ...
-
bioRxiv - Biochemistry 2021Quote: ... high glucose (Thermo Fisher Scientific, Gibco #11965084) with 10% calf serum (Gemini bio-products #100-510 ...
-
bioRxiv - Biochemistry 2021Quote: ... high glucose (Thermo Fisher Scientific, Gibco #11965084) with 10% calf serum (Gemini bio-products #100-510 ...
-
bioRxiv - Biochemistry 2021Quote: ... high glucose (Thermo Fisher Scientific, Gibco #11965084) with 10% calf serum (Gemini bio-products #100-510 ...
-
bioRxiv - Immunology 2021Quote: ... AccuPrime Tag DNA polymerase High Fidelity (Invitrogen) with initial denaturation at 94 °C for 2 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Phusion High-Fidelity DNA polymerase (Thermo Scientific) was used to amplify fragments from C ...
-
bioRxiv - Neuroscience 2022Quote: ... in DMEM (high glucose, with pyruvate) (Gibco) + 10% FCS + 1% P/S ...
-
bioRxiv - Molecular Biology 2022Quote: ... were cultivated in high-glucose DMEM (Gibco) supplemented with 10 % FCS (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... high-glucose media (Cat#11965092, Gibco, USA) containing l-Glutamine and supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Bioengineering 2024Quote: ... high glucose (DMEM-H; Gibco #11965-092), was dispensed into the plate at 3 mL per well ...
-
bioRxiv - Biophysics 2023Quote: ... Phusion high-fidelity PCR master mix (Thermofisher) was used to perform PCR reactions ...
-
bioRxiv - Neuroscience 2024Quote: ... were maintained in high-glucose DMEM (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 90% high-glucose DMEM (Gibco,11965, 092) and 10% FBS were mixed ...
-
bioRxiv - Cell Biology 2024Quote: ... were cultured in high-glucose DMEM (Gibco) with 10 % FBS (Gibco ...
-
bioRxiv - Synthetic Biology 2023Quote: ... high glucose were purchased from Thermo Fisher Scientific (MA ...
-
bioRxiv - Cell Biology 2023Quote: ... High-Five cells (Thermo Fisher Scientific, B85502) were then infected with the amplified viruses and grown in the Express Five media (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with high glucose (Gibco, Therm Fisher), 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Trichoplusia ni High Five cells (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5μL 10X High Fidelity PCR Buffer (Invitrogen), 0.5μL 10 mM dNTPs ...
-
bioRxiv - Microbiology 2023Quote: ... Phusion high-fidelity DNA Polymerase (Thermo Fisher) was used as specified by the manufacturer ...
-
bioRxiv - Developmental Biology 2023Quote: ... Platinum Taq High Fidelity (Thermo Fisher Scientific), Advantage 2 polymerase (TaKaRa Bio ...
-
bioRxiv - Biophysics 2023Quote: High Five™ insect cells (Thermo Scientific) were grown at 27 °C and 100 rpm agitation in ESF921™ insect cell-culture medium (Expression Systems) ...
-
bioRxiv - Neuroscience 2023Quote: ... AccuPrime Tak DNA Polymerase High Fidelity (Invitrogen) was used ...
-
bioRxiv - Microbiology 2023Quote: ... high glucose growth medium (ThermoFisher Scientific 11965092). Unless specified otherwise ...
-
bioRxiv - Molecular Biology 2023Quote: ... High-glucose DMEM media (Invitrogen, Massachusetts, USA), Bovine serum (Cytiva ...
-
bioRxiv - Cancer Biology 2023Quote: ... high glucose with GlutaMAX and pyruvate (Gibco) supplemented with 10% FCS ...
-
bioRxiv - Biophysics 2023Quote: ... ′High-Fidelity′ buffer (Thermo Scientific #F-530), and an annealing temperature of 64°C ...
-
bioRxiv - Immunology 2023Quote: ... Phusion High–Fidelity DNA Polymerase (Thermo Scientific) were used ...
-
bioRxiv - Microbiology 2024Quote: ... 0.08 μL Platinum High Fidelity Taq (Invitrogen) and 1.0 μL cDNA ...
-
bioRxiv - Synthetic Biology 2024Quote: Phusion® High Fidelity Polymerase (Thermo Scientific) and primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Neuroscience 2024Quote: ... High-capacity reverse transcription reagents (Applied Biosystems) were used to synthesis cDNA and gene expression was assayed using TaqMan probes (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2024Quote: ... consisting of DMEM-high glucose (Gibco, USA), 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... high glucose (Thermo Fisher Scientific, cat. 11965118) with 10% defined fetal bovine serum (HyClone Laboratories Inc. ...
-
bioRxiv - Plant Biology 2024Quote: ... Phusion High-Fidelity DNA Polymerase (ThermoFisher Scientific) was used for PCR amplification and the amplified gene was cloned in pJET1.2 vector (ThermoFisher Scientific) ...