Labshake search
Citations for Thermo Fisher :
7051 - 7100 of 10000+ citations for TRAP 5 amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... mTESR1 is exchanged with the addition of 5 ng/ml Recombinant Human BMP4 (Fisher Scientific, 314BP010). Exposure to BMP4 triggers differentiation of cells and is considered 0 hours for experimental purposes ...
-
bioRxiv - Biochemistry 2022Quote: DNA templates and primers labeled at the 5’-terminus by CY5 dye were synthesized from Invitrogen. 200μL of Labeled primer(100μM ...
-
bioRxiv - Microbiology 2022Quote: THP-1 cells were diluted to 5 x 105 cells/mL in RPMI + 10% FCS (Gibco) and treated with 100 nM phorbol 12-myrystate-13-acetate (PMA ...
-
bioRxiv - Biochemistry 2022Quote: ... frataxin (100μL of 1-5 μg/mL) was directly bound to the MaxiSorp microtiter plates (NUNC), and BSA (bovine serum album ...
-
bioRxiv - Plant Biology 2022Quote: ... using kit-specified reaction parameters in a Quant Studio 5 Real-Time PCR machine (ThermoFisher Scientific). Averaged actin and dnaJ values were used as the stably expressed normalization genes ...
-
bioRxiv - Biochemistry 2022Quote: ... while the second was added to NativePAGE Sample Buffer and 5% G-250 Sample Additive (Invitrogen) as per manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... aeruginosa isolates was measured using the fluorescent probe 3,3’-Dipropylthiadicarbocyanine Iodide (DiSC3(5)) (Thermo Scientific, UK) (36) ...
-
bioRxiv - Zoology 2022Quote: ... A final concentration of 5 nM siRNA was complexed with 2.5 µl of Lipofectamine RNAiMax (Invitrogen) and incubated in 12-well plates for 15 minutes prior to the plating of 1.3 × 105 Huh7 cells ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were cultured at 37 °C with 5% CO2 in a humidified incubator (Thermo Fisher Scientific). The cells were incubated in the T75 flask (Corning ...
-
bioRxiv - Biophysics 2022Quote: ... and completed after approximately 5 h (Thiol-Reactive Probe Labeling Protocol provided by Thermo Fisher Scientific). Labeled peptides were purified by RP-HPLC XSelect C4 column using a gradient of 30-50% B over 42 min ...
-
bioRxiv - Molecular Biology 2022Quote: Cells were cultured overnight and labeled with 5 μM C11-BODIPY581/591 (#D3861; Thermo Fisher Scientific) in 0.1% BSA/DMEM for 1 h before RSL-3 treatment ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were run on a QuantStudio 5 Real-Time PCR Instrument (A28133, Applied Biosystems, Waltham, MA). The results were analyzed with the Qiagen analysis spreadsheet provided with the kit.
-
bioRxiv - Cancer Biology 2022Quote: ... treated 5×105 PKCαKR or primary CLL patient cells were washed with 1x HBSS (ThermoFisher Scientific) at 300g for 5 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... 2014) were grown at 37 °C with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.3 µl of 5 µg/µl 10-kDa dextran conjugated with Alexa Fluor™ 488 (Invitrogen, D22910 ...
-
bioRxiv - Immunology 2022Quote: ... 5-10×106 non-activated T cells were washed in serum-free minimal essential media (ThermoFisher) and resuspended in 100 μL P3 nucleofection solution (Lonza) ...
-
bioRxiv - Cell Biology 2022Quote: ... passage 3 fibroblasts were trypsinized 5 min at 37°C using 0.05% trypsin with EDTA (Gibco), centrifuged at 1000 rpm for 5 min at RT and resuspended in HBSS (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... it was subjected to three 5 min washes in tris-buffered saline solution (28358, Thermo Fisher) with 0.05 % Tween-20 ...
-
bioRxiv - Cell Biology 2022Quote: ... and trypsinised at 37°C for 5 minutes with Trypsin-EDTA (0.05%) (Thermo Fisher Scientific, UK). Complete cell media were used to deactivate the Trypsin and the cells were then seeded at a 1:3 ratio in new Corning® T75 flasks.
-
bioRxiv - Cancer Biology 2022Quote: ... Selection and maintenance of transduced cells was achieved with 5 ug/mL puromycin (Gibco, cat. A1113803) begun 24 hours after application of lentiviral-containing media.
-
bioRxiv - Plant Biology 2021Quote: ... 0.3-5 µg of total RNA was treated with 4 U of TURBO DNase (Life Technologies) in 2 consecutive incubation steps ...
-
bioRxiv - Microbiology 2020Quote: ... pA1* cells were treated with 500µM of the protonophore TCS (3,3’,4’,5-Tetrachlorosalicylanilide; Fisher scientific). The fluorescent signal from at least 100,000 individual bacteria per condition was measured by flow cytometry with a MCSQuant® VYB analyzer (Miltenyi Biotec ...
-
bioRxiv - Neuroscience 2020Quote: ... The water contained 1 mg/mL 5-ethynyl-2-deoxyuridine (EdU) (Thermo Fisher Scientific, Cat. # E10187) and 1% sucrose ...
-
bioRxiv - Cancer Biology 2020Quote: ... adapter-ligated template was digested with 5 U of AmpErase Uracil N-Glycosylase (Life Technologies, N8080096). Libraries were then PCR amplified and indexed using Phusion Hot Start II High Fidelity Polymerase (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were resuspended and incubated in 5 mL of RBC lysis buffer (Invitrogen, 00-4333-57) for 5 min on ice ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were grown in Dulbecco modified Eagle medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), penicillin and streptomycin (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg of total RNA was used for reverse transcription using SuperScript III Reverse Transcriptase (Thermofisher) according to manufacturer’s manual ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were grown as monolayers in Ham’s F-12 medium (Biowhitaker) supplemented with 5% FBS (Gibco), 1x antimycotic/antibiotic solution (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA samples (5 μg of each) were treated with RNase-free DNase I (Thermo Fisher Scientific) in the presence of RiboLock (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2020Quote: ... Quantitative Real-Time Polymerase Chain reaction (qPCR) was performed using a QuantStudio 5 (Thermo Fisher Scientific) with primers ...
-
bioRxiv - Immunology 2020Quote: ... washed 2 × 100μL with complete RPMI and stained with 5 nM TMRE (T669, Thermo Fisher Scientific) in 200 μL complete RPMI at RT for 20 min ...
-
bioRxiv - Microbiology 2021Quote: Quantitative PCR reaction mix consisted of 5 µL 2x Power SYBR Green Master Mix (Applied Biosystems), 1 µL DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary cortical neurons were cultured for 5 days and then transfected using Lipofectamine 2000 (ThermoFisher # 11668019). Cells were incubated with 0.5 μl Lipofectamine 2000 and 100ng pGW1-mApple plasmid construct per well as a morphology marker as described35 ...
-
bioRxiv - Physiology 2021Quote: ... 1-2 µg of vector DNA was mixed with 5 µl of Lipofectamine™ (Thermo Fisher) in OPTIMEM-I media (GIBCO ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primer extension was performed with 2 pmol of DNA gene-specific primers (5’CATGCTTAACGTAATTCAACAGAAATTATATG) by Invitrogen SuperScript III reverse transcriptase ...
-
bioRxiv - Neuroscience 2021Quote: ... The supernatant was bound to 5 mL of Nickel-NTA agarose resin (Thermo Scientific, Waltham, MA) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... and maintained at 37degrees and a 5% CO2 environment in culture medium (MEM medium (Life Technologies), 20% horse serum ...
-
bioRxiv - Microbiology 2021Quote: ... Vero E6 cells were maintained at 37°C and 5% CO2 in complete DMEM (ThermoFisher, 11965092) supplemented with 10% heat inactivated FBS ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR detection of SARS-CoV-2 was performed on a QuantStudio 5 instrument (Applied Biosystems) using a TaqPath 1-step RT-qPCR Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... each well was transfected with 5 pmol of individual dsiRNAs using Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... UltraComp eBeads™ and mouse IL-5/IL-13 ELISA kits were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were stained with 5 μg/ml of 5,5′,6,6′-tetraethylbenzimidazolyl-carbocyanine iodide (JC-1; Invitrogen) for 30 min at 37 °C following a published procedure(17) ...
-
bioRxiv - Bioengineering 2021Quote: ... The suspension was then filtered using a micro-centrifugal filter (cat. no. F2517-5, Thermo Scientific) at 8,000 g for 20 min ...
-
bioRxiv - Bioengineering 2021Quote: ... washed with 5 column volumes binding buffer and then eluted with 2.5 mM Desthiobiotin (ThermoFisher, US) in binding buffer on an Äkta Pure FPLC (GE healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of RNA was treated with the Ambion Turbo DNAse kit (ThermoFisher Scientific, Waltham MA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Running conditions used were 4–12% Bis-Tris gel in 5% MOPS Running Buffer (Invitrogen, NP0001) at 200 V for 1 h ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were filtered and incubated for 5 minutes in 1:1000 Hoechst (Invitrogen H3569, Waltham MA). 10,000 Hoechst + nuclei from the suspension were then sorted directly into 10x Genomics RT buffer (Pleasanton ...
-
bioRxiv - Developmental Biology 2022Quote: ... Soluble chromatin (5 µg) is immunoprecipitated with Protein A/G Dynabeads (Thermo Fisher Scientific, 10002D, 10004D) and 10μg of H3K27ac (Diagenode ...
-
bioRxiv - Microbiology 2022Quote: ... with 1:5 diluted cDNA in technical duplicate in a StepOne Plus qPCR instrument (Applied Biosystems). A standard curve made from plasmid encoding the gene of interest or a purified PCR product was used to enumerate gene copies in each sample ...
-
bioRxiv - Microbiology 2022Quote: ... blotted for 5 s and plunge-frozen into liquid ethane in a Vitrobot Mark IV (ThermoFisher), while the blotting chamber was maintained at 100% humidity at 10 °C ...