Labshake search
Citations for Thermo Fisher :
7001 - 7050 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... were designed using online software (http://www.primer3plus.com/) and gene expression was detected on the Applied Biosystems QuantStudio 5 real-time PCR system (Applied Biosystems, New York, USA). PCR conditions were as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... Gene expression was assessed with real-time quantitative polymerase chain reaction (qPCR) using SYBRTM Green PCR Master Mix (Thermo Fisher Scientific, MA) on a Roche LightCycler 480 II (Roche ...
-
bioRxiv - Plant Biology 2024Quote: RT-qPCR was carried out in 96-well plates with three technical replicates per sample using a StepOnePlusTM Real-Time PCR System (Applied Biosystems, USA). RT-qPCR design ...
-
bioRxiv - Physiology 2024Quote: ... The qPCR reactions were run on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific, Life Technologies Corporation, Carlsbad, California USA) in 384 well plates.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Quantitative polymerase chain reaction (qPCR) analysis was performed using a QuantStudio 12 K Flex real-time PCR system (Applied Biosystems, United States) and Luminaris color probe qPCR master mixes (Thermo Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... The resulting cDNA was then used for real-time qPCR with the Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712-02) using the Quant Studio™ 6 Flex Real-Time PCR system (Thermo Fisher). The mRNA levels of GAPDH or actin were used as an internal control to normalize the mRNA levels of genes of interest ...
-
bioRxiv - Cell Biology 2024Quote: ... The qPCR was conducted using the Taq Pro Universal SYBR qPCR Master Mix (Vazyme Biotech, China) in the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, USA). The 2−△△CT method was used to calculate the relative expression (Livak & Schmittgen ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were subjected to a heating ramp from 25°C to 95°C at a rate of 1°C/s using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, USA). Data was analyzed by Protein Thermal Shift Software v1.4 to obtain melting temperature (Tm).
-
bioRxiv - Neuroscience 2023Quote: ... qPCR reactions were run using the Fast mode on a QuantStudio™ 3 Real-Time PCR Instrument (Applied Biosystems by ThermoFisher, A28131). Data were normalized against actin (Actb ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... was used to assess the number of cycles necessary to amplify libraries to the concentration needed for sequencing by amplifying 1 uL of library with LabTAQ Green Hi Rox master mix (Labtech) and adapter-targeted primers on a StepOnePlus Real-Time PCR system (Thermofisher Applied Biosystems). Indexing PCR involved double indexing (Kircher et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... performed on an Applied Biosystem StepOne Real-Time PCR System using the Fast SYBR Green master mix (Fisher Scientific, 43-856-18). ΔCt values were used to calculate the relative levels of the mRNA of interest which were normalized to the mRNA levels of GAPDH ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR reactions were run using the “Fast” mode on a QuantStudio™ 3 Real-Time PCR Instrument (Applied Biosystems by ThermoFisher, A28131). Probes used for various genes are listed in Table X ...
-
bioRxiv - Cell Biology 2023Quote: ... and subjected to SYBR® Green chemistry-based qPCR using the QuantStudio 3 Real-time PCR System (Applied Biosystems, Foster City, CA). Primers were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... qPCR reactions were performed using primers designed on primer BLAST (Table 5).99 Reactions were performed in triplicate (both biological and technical) in a 384-well plate using the ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) or the 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2022Quote: ... and the cDNA was used to measure the expression of genes of interest via Real Time PCR (Applied Biosystems 7500 Fast, USA). Primers used for real time PCR are as follows-MuSocs3 Forward- 5’-CGCCCAGGTCCTTTGCCTGA-3’ MuSocs3 Reverse- 5’-CCGCATCCCGGGGAGCTAGT-3’ MuMafb Forward- 5’-GGCAGGGAGTCTCTGTCGGC-3’ MuMafb Reverse- 5’-CAGGCCCTCCGACCCCATCT-3’
-
bioRxiv - Cell Biology 2023Quote: ... The experiment was performed as per the Profiler array format C protocol on a StepOnePlus™ Real-Time PCR System (Applied Biosystems). Data analysis was carried out using the Qiagen GeneGlobe RT-qPCR Data Analysis web tool.
-
bioRxiv - Microbiology 2023Quote: ... Gene expression was quantified on QuantStudio 6 PRO Real-Time PCR System using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems) and gene-specific primers (Table S4) ...
-
bioRxiv - Plant Biology 2023Quote: ... Final quantification of each library was determined according to Illumina qPCR guide with a KAPA SYBR Fast Mastermix Low ROX (Peqlab, Germany) in a QuantStudio 5 real-time PCR system (Applied Biosystems, USA). Final libraries were normalized with elution buffer (Qiagen ...
-
bioRxiv - Systems Biology 2023Quote: ... qPCR was performed in biological and technical triplicate using an Applied Biosystems QuantStudio 3 Real-Time PCR System with Fast SYBR Green Master Mix (Thermo Fisher 4385617). Relative transcript abundance was calculated using the ΔΔCt method (Livak and Schmittgen 2001) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative PCR was performed on an Applied Biosystems QuantStudio 6 Flex Real-Time PCR System using Fast SYBR Green Master Mix (Applied Biosystems, #4385612). The relative gene expression was calculated using the 2−ΔΔCt method with GAPDH as endogenous control for normalization.
-
bioRxiv - Immunology 2023Quote: ... followed by 40 cycles at 95°C for 15 sec then 60°C for 1 min using a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). Extracted MAC DNA was used as the quantification standard.
-
bioRxiv - Plant Biology 2023Quote: ... Quantification of cDNA was done by qPCR (applied biosystems 7900ht real-time PCR) with SYBRTM Green master mix (Thermo Fisher, https://www.thermofisher.com/). Relative expression was calculated based on the delta CT method (Livak and Schmittgen ...
-
bioRxiv - Cell Biology 2023Quote: ... was used to amplify the genes of interest according to the primers mentioned in the Table 1 from 15-20 ng of cDNA in the QuantStudio 6 Flex Real-Time PCR system (Thermo Fisher Scientific) machine ...
-
bioRxiv - Immunology 2023Quote: ... qPCR was performed using a PowerUp SYBR Green Master Mix and standard protocols on an Applied Biosystems QuantStudio 6 Real-Time PCR System (Thermo Fisher Scientific). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1μl of cDNA was used per well in a total of 10μl reaction mix for amplification using the StepOne Real Time PCR (Applied Biosystems, Carlsbad CA). The amplification conditions consisted of an initial cycle of 95°C for 5 minutes followed by 40 cycles of amplification with denaturation as follows ...
-
bioRxiv - Immunology 2023Quote: ... in order to conduct real-time PCR using the indicated primer pairs from PrimerBank (24) (Table S1) with SYBR Green master mix (ThermoFisher, Waltham MA).
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR amplification was performed at 95 °C for 2 minutes and subsequently 40 cycles of 95 °C for 2 s and 60 °C for 20 s on a QuantStudio Real-Time PCR System (Thermo Fisher Scientific). The relative expression of different target RNAs in RNA samples isolated with different methods was analyzed using their Ct values in RT-qPCR ...
-
bioRxiv - Genomics 2023Quote: Levels of H3K27ac CUT&Tag binding signal was determined by qPCR amplification carried out with the QuantStudio™ 5 Real-Time PCR System (ThermoFisher A34322) using the Standard Curve experiment type and SYBR Green Master Mix (ThermoFisher 4309155) ...
-
bioRxiv - Cancer Biology 2023Quote: Optimum number of cycles for cDNA amplification were determined by qPCR analysis using the StepOnePlus™ Real-time PCR system (#4376600, Applied Biosystems) and the KAPA SYBR® Fast qPCR kit master mix (2X ...
-
bioRxiv - Cell Biology 2023Quote: ... and 60°C for 20 seconds) in a QuantStudio TM 6 Flex Fast Real-Time PCR System (Life Technologies, Grand Island, NY). Q- PCR was conducted in triplicate for each sample.
-
bioRxiv - Genomics 2023Quote: ... The reactions were run on an ABI Quant Studio 3 real-time PCR system (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). The gene expression levels were calculated with the 2-ΔΔCT method (Livak and Schmittgen 2001).
-
bioRxiv - Cancer Biology 2023Quote: ... 1μl of sample was mixed in 20μl final of SoFast-Green reaction mix containing 10nM of forward (CCGTCTTAAGTTTGATTTT) and reverse (AGAGGTGGACCAACTCGGTA) primers for MVMp NS1 gene amplification using the StepOnePlus real-time PCR system (Thermo Fisher Scientific). Primers targeting the 18S gene were used for normalization (forward ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR reactions were run using the Fast mode on a QuantStudio™ 3 Real-Time PCR Instrument (Applied Biosystems by ThermoFisher, A28131). Data were normalized against actin (Actb ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time qPCR was performed using a THUNDERBIRD SYBR qPCR Mix (TOYOBO, Osaka, Japan) with the Step One Plus Real-Time PCR system (Applied Biosystems, USA). Information on primers is shown in S ...
-
bioRxiv - Plant Biology 2023Quote: ... Relative enrichment levels were determined by ChIP-qPCR in an optical 384-well plate in the QuantStudio™ 6 Flex Real-Time PCR System (ThermoFisher Scientific), using FastStart Universal SYBR Green Master (Rox ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative real-time PCR was performed in triplicate on the 5x diluted cDNA using the fast SYBR green master mix (Thermo Fisher, 4385612) to assess the relative changes in gene expression ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR reactions were run using the “Fast” mode on a QuantStudio™ 3 Real-Time PCR Instrument (Applied Biosystems by ThermoFisher, A28131). Probes used for various genes are listed in Table X ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs were diluted 2.5 times in water and RNA expression level was assessed by real time quantitative PCR (RTqPCR) using the Power SYBR Green Master Mix (Thermo Fisher Scientific) and ViiA-7 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Experiments were conducted on a QuantStudio™ 5 Real-Time PCR System using a 384-well format (Thermo Fisher, Waltham, MA, USA). Data analysis was executed using the 2ΔΔCt method ...
-
bioRxiv - Neuroscience 2023Quote: ... according to the manufacturers protocol and was read on an Applied Biosystems® ViiA 7 Real-Time PCR System and analysis was conducted on QuantstudioTM Software by Applied Biosystems. The layout of the PCR array 96-well plate consisted of probes/primers for 84 inflammasome-associated genes ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR was performed using an Applied Biosystems® ViiA 7 Real-Time PCR System and analysis was conducted on QuantStudioTM Software by Applied Biosystems. Minus reverse transcriptase and no-template cDNA controls were included ...
-
bioRxiv - Genomics 2023Quote: ... cDNAs were diluted 2.5 times in water and RNA expression level was assessed by real time quantitative PCR using the Power SYBR Green Master Mix (Thermo Fisher Scientific) on a ViiA-7 Real-Time PCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Relative quantity of mRNA was determined using StepOne Real-Time PCR Systems with the Maxima SYBRgreen qPCR master mix system (Thermo Fisher Scientific). Relative gene expression was calculated following normalization to housekeeping gene 29S mRNA levels using comparative Ct (cycle threshold ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative analysis of IL-6 and IFNB expression in THP1 dual reporter cells was performed by StepOne Real-Time PCR Systems (Thermo Fisher Scientific) by using 18S rRNA for normalization ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR reactions were run on the CFX Opus 96 Real-Time PCR System using SYBR Select Master Mix for CFX (Applied Biosystems #4472937) in biological and technical triplicate ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was performed on a Thermo Fisher Scientific QuantStudio 12K Flex using TaqMan™ Fast Advanced Master Mix (Thermo Fisher). TaqMan primers (Thermo Fisher ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... MicroAmp™ Optical 384-Well Reaction with 10µL reactions were loaded into a QuantStudio™ 5 Real-Time PCR System (Applied Biosystems) and run according to the following recommended program 10 min 55C ...
-
bioRxiv - Biochemistry 2023Quote: ... The reaction mixtures were heated from 10°C to 70°C for approximately 1 hr by a QuantStudio 7 Pro Real-Time PCR System (Thermo Fisher Scientific). Approximately 770 evenly spaced measurements of fluorescence against the temperature gradient were recorded and processed by QuantStudio V1.3 (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Real-time PCR was performed to measure the relative mRNA levels using the QuantStudio™ 5 Real-Time PCR System with SYBR Green Master Mix (Applied Biosystems). The primer sequences are described in supplementary table 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was isolated by phenol-chloroform extraction followed by an ethanol precipitation and analyzed by qPCR using StepOnePlus Real-Time PCR System (Thermo Fisher Scientific) and SYBR Green Master Mix (Thermo Fisher Scientific ...