Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for 7 HYDROXY 5 METHYL 1 3 4 TRIAZAINDOLIZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... containing 80μL N-methyl-trimethylsilyl-trifluoroacetamide (MSTFA; ThermoFisher #TS48915) and gently vortexed followed by 30 min dry heat incubation at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... 12.5 mM methyl-α-d-mannopyranoside (Thermo Fisher Scientific), 100 U/ml penicillin ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were stained with tetramethylrhodamine methyl ester (TMRM) (Invitrogen) at a non-quenching concentration (20nM) ...
-
bioRxiv - Genetics 2023Quote: ... and Tetramethylrhodamine methyl ester (TMRM, 0.1µM, Thermo Fisher I34361) for 30 minutes at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2024Quote: ... and tetramethylrhodamine methyl ester perchlorate (TMRE) (ThermoFisher, Waltham, MA) dyes ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Bioengineering 2021Quote: ... Apoptosis was detected by incubating devices with 5μM of CellEvent™Caspase 3/7 Green detection reagent (Invitrogen) for 30 minutes at 37°C.
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... splenic NP366-374 TMEM were assessed with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay kit (ThermoFisher). Lung single cells were stained with surface markers then incubated with caspase 3/7 green detection reagent for 30 minutes at 37°C as described in the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...
-
bioRxiv - Cell Biology 2022Quote: Live/Dead™ Cell Imaging Kit and CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) were used for detection of cell apoptosis based on the manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... 10% H2/N2 (BOC) for 3 days on blood agar plates containing 7% laked horse blood (Thermo Scientific) and the Campylobacter selective supplement “Skirrow” containing the antibiotics trimethoprim ...
-
bioRxiv - Microbiology 2022Quote: ... Proliferating organoids were grown for 4–7 days and dissociated using TrypLE Express Enzyme (Thermo Fisher Scientific) for 10–20 minutes in a 37°C water bath ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cell between passage 4 to 7 were transfected with si-SLC38A5 siRNA (Cat# 4392420, Thermo Fisher Scientific) or negative control siRNA (si-Ctrl ...
-
bioRxiv - Microbiology 2023Quote: ... Parasites (CDC1132 or G3 strain) were labelled with Cell Tracker Blue CMAC (7-amino-4-chloromethylcoumarin) (Invitrogen), added to confluent BPH-1 cells (1:3 parasite ...
-
bioRxiv - Developmental Biology 2020Quote: ... ToPro-3 (1:1000, Invitrogen). Secondary antibodies used in this study were purchased from Invitrogen and include ...
-
bioRxiv - Cell Biology 2019Quote: ... BODIPY-493/503 Methyl Bromide (used at 1/1000 from 1 mg/ml ethanol stock) and CellTracker green (C2925) from Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: The purified RNA was used to amplify cDNA from the gUTRGFP template with the 5’ Cy-5 labelled pWP252fluor primer (5’ ATAACGGACTAGCCTTA 3’) using the standard Superscript III First-Strand Synthesis System (Thermo Fisher) with 3 µg of total RNA and elongating at 52.5°C for 60 min ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Microbiology 2020Quote: ... and probe E_Sarbeco_P1 (5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ-3′) using the TaqPath 1-Step Multiplex Master Mix kit (Applied Biosystems) on a QuantStudio 5 real-time PCR system (Appiled Biosystems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Neuroscience 2021Quote: ... slides were washed in 3×5’ PBS and incubated in goat-α-rabbit-555 (1:1000, Life Technologies, A21207) in PBS for 90’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were washed in 0.1 M TB (3 ×5 minutes) and then incubated in goat anti-chicken Alexa 488 (1:1000, #A11039, Invitrogen), goat anti-rabbit Alexa 568 (1:500 to 1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Immunology 2023Quote: ... Following preset incubation times (0, 0.5, 1, 3, or 5 h) cells were harvested by trypsinization (500 μl TrypLE, Gibco) for 5 min at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were washed 4 × 5 min with PBS before incubating with secondary antibodies (1:1000 Alexa fluorophores, ThermoFisher) in blocking solution for 1 hr at room temperature ...
-
In vivo imaging of the kinetics of microglial self-renewal and maturation in the adult visual cortexbioRxiv - Neuroscience 2020Quote: ... clone G-A-5) followed by a secondary antibody solution (4 h, RT, AlexaFluor 594, 1:500, Invitrogen), mounted and coverslipped ...
-
bioRxiv - Developmental Biology 2022Quote: ... centrifuged at 500xg for 5 min at 4°C and resuspended in 1% BSA in PBS (AM2616, Invitrogen) containing 200 U/μl RNase inhibitor (3335402001 ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked for 1 hour in 5 % normal donkey serum in 3% PBST and then incubated in chicken anti-GFP (Invitrogen, A10262, 1:1000) overnight at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... pRSV-Rev = 5: 3: 2) were co-transfected into HEK-293T cells at a ratio of 1:1 using lipofectamine 3000 (Invitrogen, USA, Cat: #L3000015). After 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... An imaging window was constructed from three layers of microscope cover glass (1 x 5 mm, 2 x 3 mm diameter, Fisher Scientific, no. 1) joined with a UV-curable optical glue (NOR-61 ...
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membrane was washed 5 times 5 min in TBS-T prior to overnight incubation at 4°C with 1° anti-Flag antibody (1:500, ThermoFisher, PA1-984B). The next morning ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysis buffer (20 mM Tris pH 7.4, 150 mM NaCl, 5 mM MgCl2, 1% Triton X-100, 1 mM DTT, 25 U/ml DNase TURBO, Invitrogen cat#AM2238) had been added to the frozen monolayer ...
-
bioRxiv - Cancer Biology 2024Quote: ... final concentration: 5 µM) and 4 µL of 1 mg/mL Hoechst 33342 dye (1:500 dilution) (Life technologies, Eugene, OR, USA) and resuspended thoroughly using a low binding pipette tip ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-5 × 105 cells were settled on Polysine Slides (Thermo Fisher), fixed with 4% ...
-
bioRxiv - Cancer Biology 2019Quote: ... human 36B4 RT 5′-CCCATTCTATCATCAACGGGTACAA-3′) using Superscript III (Thermo Fisher) at 55 °C for 1 h ...
-
bioRxiv - Neuroscience 2020Quote: ... FIVNC-555p (5’-FAM-CATGGCCACATTAATAATGG CGCA -TAMRA-3’ (Applied Biosystems, CA). These reactions were performed with a Bio-Rad iCyclerTM iQ and analyzed using the manufacturer’s software ...
-
bioRxiv - Cell Biology 2022Quote: ... DLP1-sense strand: 5’-UCCGUGAUGAGUAUGCUUUdTdT-3’ 31 (Ambion, Austin, TX, USA).
-
bioRxiv - Cancer Biology 2019Quote: ... 5’-CAGGGGTGCAGCTTGATTTC-3’ 7500 Fast Real-Time PCR System (Applied Biosystems) using optimized conditions for SYBRGreen I dye system ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against MyoVa was obtained from Invitrogen (s9207, 5’ GUAUAGUCCUAGUAGCUA 3’) as this was shown to work well by Wu et al (2018) ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were run on a Quantstudio 3 or 5 instrument (ThermoFisher). Cycling conditions for Quantifast reagents were ...
-
bioRxiv - Neuroscience 2023Quote: ... or CRMP2 siRNA (5′ GTAAACTCCTTCCTCGTGT-3′; obtained from Thermo Fisher Scientific) using the 4D-Nucleofector (P3 Primary Cell Solution ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 days after transfection by 5 µl of lipofectamine 2000 (Invitrogen) with 2 µg of the plasmid and regularly re-sorted to maintain expression of myr/palm-mCherry.
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using TryplE (Gibco 12604054). Naïve and primed hPSCs were expanded and induced into different lineages in a 5% CO2 incubator at 5% O2 at 37C.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5’- TTGGATCAGCTCAGACATATT-3’ or a nonspecific “scrambled” control (Invitrogen, United States). 72 hours after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anticlaudin 7 (Invitrogen Cat#37-4800, 1:100 for IF); rabbit anti-ARPC2 (Abcam Cat#ab133315 ...
-
bioRxiv - Genomics 2023Quote: ... cells were resuspended at 1 × 10^7 in 90% FBS (ThermoFisher) 10% DMSO (Sigma Aldrich) ...