Labshake search
Citations for Thermo Fisher :
851 - 900 of 10000+ citations for 7 HYDROXY 5 METHYL 1 3 4 TRIAZAINDOLIZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... the media was replaced with DMEM + 10% FBS + CellEvent Caspase-3/7 Detection Reagent (Green) according to the manufacturers recommendations (Invitrogen). The plate was then imaged every 15 minutes using phase and GFP channels in the ZEISS Celldiscoverer 7 Automated Live Cell Imager set to 42°C at 5% CO2 and 20% O2 ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Developmental Biology 2021Quote: ... These lines were routinely passaged every 3-4 days using Versene (ThermoFisher; 15040066). All lines were routinely screened for differentiation and tested for mycoplasma contamination.
-
bioRxiv - Biophysics 2022Quote: ... DiD (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate salt) was purchased from ThermoFisher scientific (Molecular probes ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibody incubation was performed for 3-4 days and DiD (Thermo Fisher Scientific-Molecular Probes L7781 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-4 brains were dissected in chilled Schneider’s Drosophila medium (ThermoFisher Scientific, 21720001) in less than 5 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... that accumulates in hyperpolarized membranes and DiBAC(4)3 (Thermo Fisher Scientific, USA) that enters depolarized cells (Suchodolski and Krasowska ...
-
bioRxiv - Cell Biology 2021Quote: ... Bolt 4-12% Bis-Tris or NuPAGE 3-8% Tris-Acetate gels (Invitrogen) were used for electrophoresis ...
-
bioRxiv - Developmental Biology 2021Quote: ... and passaged every 3 – 4 days using Versene (Cat. # 15040066, Thermo Fisher Scientific). Culture dishes were pre-coated with 0.5% GelTrex matrix solution (Cat ...
-
bioRxiv - Neuroscience 2023Quote: ... 3/4 of the medium was replaced with Neurobasal medium (GIBCO, 21103-049) containing B27 and glutamax ...
-
bioRxiv - Cancer Biology 2023Quote: ... and resolved on 3-8% or 4-12% gradient SDS-PAGE gels (ThermoFisher) transferred to nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-4 days using TrypLE Express (ThermoFisher, Cat# 12605036) and confirmed to be free of mycoplasma ...
-
bioRxiv - Neuroscience 2023Quote: ... After 3–4 days the colonies were dissociated using StemPro Accutase (Thermo Fisher), counted and plated at low confluency (10,000 cells/cm² ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were split every 3-4 days when confluent using TrypLE Express (Gibco). For all immunoblotting and imaging experiments ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-NDBG [2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose] (N13195) were purchased from Invitrogen. Recombinant murine SCF (250-03) ...
-
bioRxiv - Pathology 2019Quote: The infected rice sheaths were incubated with CellTracker™ Blue CMAC Dye (7-amino-4-chloromethylcoumarin, Molecular Probes, C2110) at a final working concentration of 10 μM for 2 h at 37 °C ...
-
bioRxiv - Physiology 2019Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in PBS at 5 mg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Glucose uptake assay was performed by incubating cells with 50 µM 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (Invitrogen) for 90 min at 37°C prior to cell staining ...
-
bioRxiv - Biochemistry 2019Quote: ... 7 μl of Superscript III reverse transcription master mix (containing 4 μl of 5x First Strand Buffer (Life Technologies), 1 μl of 100 mM DTT ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were stained with 250 μM Cell Tracker Blue CMAC (7-amino-4-chloromethylcoumarin) dye (Life Technologies, Carlsbad, CA). Cells were then plated onto 35 mm glass bottom microwell dishes that were poly-d-lysine coated (MatTek Corporation ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in glucose-free media containing 150 μM 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG Thermofisher) and incubated for 45 minutes at 37°C.
-
bioRxiv - Neuroscience 2023Quote: Organ of Corti explants were dissected at postnatal day 4 through 7 (P4-P7) in Leibovitz’s L-15 cell culture medium (Invitrogen), containing the following inorganic salts (in mM) ...
-
bioRxiv - Cell Biology 2024Quote: Cells cultured for 4 days at a starting density of 7 x 104/cm2 were lysed in TRIzol (Ambion) for 5 min and transferred to an RNA-free microcentrifuge tube following manufacturer recommendations ...
-
bioRxiv - Immunology 2023Quote: ... Raji B cells were labelled in serum-free medium with 10 μM 7-amino-4-chloromethylcoumarin (CMAC, Thermofisher, USA) for 1 hour at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... ToPro-3 1:1000 and TMRM 1:100,000 (Invitrogen) added and incubated for 10 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLV-mCherry at ratio 1:1:1 (i.e. 5:5:5 μg) using Lipofectamin™ 3000 transfection reagent (Thermo-Fisher Scientific, #L3000015). Pseudoviruses harvested from the supernatant at 48 h 72h post-transfection were filtered (0.44 μm ...
-
bioRxiv - Neuroscience 2021Quote: ... we added a 1 mL of the following mixture to the culture media and incubated the cells at 25°C incubator for 1—3 hours: 5 μM Fura-2 AM (F-1201, Life Technologies), 250 μM probenecid (162-26112 ...
-
bioRxiv - Neuroscience 2020Quote: ... tissues were washed in PBS (3×5 min) and incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:400; goat anti–rabbit; Life Technologies) or Alexa Fluor 594 (1:400 ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 µl of 3 ng µl-1 cDNA was used as template in the QuantStudio 5 Real-Time PCR system (Applied Biosystems). Amplifications were performed with 5 μl of SYBR® green JumpStart Taq ReadyMix (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slices were then washed in PBS (3 × 10 min) followed by a 5 min incubation with DAPI (Thermofisher Scientific, 1: 5000) diluted in PBS ...
-
bioRxiv - Immunology 2020Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5′AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... with cDNA (diluted 1:5) and gene-specific primers (Key Resources Table) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) in triplicate ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were washed in 0.3% Triton-X/PBS 3× 5 min and incubated with secondary antibody (goat anti-rabbit-Alexa Fluor 594: 1:800, Life Technologies) for one hour ...
-
bioRxiv - Cell Biology 2021Quote: ... Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200, Life Technologies) diluted in 10% FBS for 1 hour at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries were washed 3 times for 5 min with PBTx before incubation at room temperature in 1 μg/mL DAPI (Invitrogen, ThermoFisher Scientific) solution in PBS for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 μM 6-JOE-conjugated reverse primer (5’-6-JOE-GATGATCTCCACCTTGCCGT-3’) was extended with 1 pmol of RNA as template using Superscript III (Thermo Fisher) as reverse transcriptase ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Cell Biology 2023Quote: ... mouse calvariae were dissected from 1–3 days old neonatal mice and digested sequentially 5 times for 25 minutes in α-MEM (Gibco) containing 0.1% collagenase (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... Ovaries were washed 3 times for 5 min with PBTx before incubation at room temperature in 1 μg/mL DAPI (Invitrogen, ThermoFisher Scientific) solution in PBS for 30 minutes ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...