Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 7 HYDROXY 5 METHYL 1 3 4 TRIAZAINDOLIZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Target cell killing was measured using CellEvent™ Caspase-3/7 Green Detection Reagent (Life Technologies) and analyzed by flow cytometry.
-
bioRxiv - Neuroscience 2019Quote: Dead and apoptotic cells were detected using CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... Caspase activity was assessed using CellEvent(tm) Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen) following manufactures protocol ...
-
bioRxiv - Genomics 2021Quote: ... Laser Capture Microdissection (LCM; N=3; 7 µM glass slide coated with polyethylene naphthalate – ThermoFisher #LCM0522), multiplex or regular immunohistochemistry (N≥3 4 µM glass slide ...
-
bioRxiv - Developmental Biology 2024Quote: ... follicles were incubated with 500 nM CellEvent™ Caspase-3/7 Green Detection Reagent (C10427, Invitrogen). Oocytes were stained with 150 nM Sir-Tubulin (CY-SC002 ...
-
bioRxiv - Immunology 2019Quote: ... stained with 7-AAD (Thermo Fisher, #A1310; 1:1000) to identify dead cells ...
-
bioRxiv - Neuroscience 2020Quote: ... CAMKII-Phospho-286/7 (1:1000; 22B1; Thermo Fisher), TUJ1 (1:1000 ...
-
bioRxiv - Genomics 2020Quote: ... and with 7-AAD (Invitrogen #A1310, 1:200 dilution) for 5 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1 mM 7-Aminoactiomycin D (Thermo Fisher Scientific) and analysis by Flow Cytometry using a LSRFortessa X20 (BD Biosciences).
-
bioRxiv - Immunology 2022Quote: ... 7-AAD (ThermoFisher, Cat# 00-6993-50, 1:20), PE/Dazzle 594 CD21 (Biolegend ...
-
bioRxiv - Bioengineering 2023Quote: ... 1:500 of 7-AAD (Invitrogen, #00-6993-50) nuclei staining solution was added and nuclei were gated from the debris (Supplementary Figure 7 ...
-
bioRxiv - Cell Biology 2023Quote: ... Once 1 uL of 7-AAD (Thermo Fisher Scientific) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells (1 × 107) from passage 5-7 were used for transplantation after staining with carboxyfluorescein succinimidyl ester (CSFE) (Invitrogen, Carlsbad, California, USA) on the day of the transplantation ...
-
bioRxiv - Physiology 2024Quote: ... The starvation assay consisted of placing 5-7 day-old female DTKR-RNAi flies and control flies into vials containing 1% aqueous agar (Fisher Scientific, USA) [48,73].
-
bioRxiv - Immunology 2023Quote: ... cDNA was diluted 1:3 or 1:4 before mixing with Power SYBR Green PCR Master Mix (CAS: 4368702, Applied Biosystems) and primer pairs (Table S4B) ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Developmental Biology 2021Quote: Embryos and larvae from 9 hpf to 4 wpf were incubated in 3 µM 5-Ethynyl-2′-deoxyuridine (EdU; ThermoFisher Scientific, cat#: C10639) in FSW for 15-30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Rev: 5’-TCATTGAGACACCATTTGTC-3’ were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher 450030) and sequence verified.
-
bioRxiv - Bioengineering 2020Quote: ... Scaffolds were washed in PBS at every timepoint (day 1, 4, 7, 14, 28) and placed in a solution of alamarBlue® (Invitrogen, California, USA) in an incubator at 37°C on a shaker ...
-
bioRxiv - Cell Biology 2019Quote: 1.5 cm-thick intact human brain slice (Number 7, see Fig. S3) was randomly chosen and passively incubated with 400 ml TO-PRO-3 (T3605, Thermo Fisher, 1:2000 dilution) in PBS at room temperature for 1 week ...
-
bioRxiv - Cell Biology 2022Quote: ... VOs we’re fixed for 1 hour in 4% paraformaldehyde solution (Thermo Fisher Scientific, 7732-18-5) in PBS and for 2 hours in 2.5% glutaraldehyde in PHEM buffer (TAAB ...
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined (Figure S4 ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4 µM TO-PRO-3 Iodide (TOPRO, Thermo Scientific). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA) ...
-
bioRxiv - Cell Biology 2019Quote: ... FM™ 4-64 Dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) was purchased from Invitrogen. Rapamycin was purchased from LC Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse ENKD1 shRNA (nucleotides targeting 403-423 bp, 5′-CGCTCACCCAAGTATGACAAT-3′) were cloned into pLKO.1 (Invitrogen).
-
bioRxiv - Neuroscience 2022Quote: ... the brains were immersed in a 1:1-mixture of ethanol and methyl salicylate (Fisher Scientific GmbH, Schwerte, Germany) for 20 min and then in 100% methyl salicylate for about 1 h at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Neuroscience 2021Quote: ... brains were then incubated in secondary antibodies (diluted in 5% serum in PBT at 4°C for 2–4 days): Alexa 488 anti-Chicken IgY (Invitrogen A11039; 1:400); Atto 647N anti-mouse IgG (Rockland 610-156-121 ...
-
bioRxiv - Immunology 2022Quote: ... and 250nM tetramethyl rhodamine methyl ester (TMRM, ThermoFisher) for 30 minutes at 37°C prior to extracellular staining and flow cytometry ...
-
bioRxiv - Immunology 2024Quote: ... 100 nM tetramethylrhodamine methyl ester (TMRM, ThermoFisher Scientific). 500 nM CellROX or 1 μM MitoSOX in HBSS at 37°C for 20 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... followed by 3–4-hour incubation at 4°C with protein A/G agarose (20421, Invitrogen). The beads were then collected for western blot detection ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight in mouse anti-Hu primary antibody at 4°C (1:200 in 3% block; Invitrogen). After three 5-min PB rinses at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... 4) counterstained with the nuclear dye TO-PRO-3 (diluted 1:10’000; Life Technologies, Inc., Gaithersburg, MD, USA). Finally ...
-
bioRxiv - Microbiology 2021Quote: ... Paris) and pCMV-VSV-G at a ratio of 4:3:1 with Lipofectamine 3,000 (Thermo Fisher Scientific). Supernatants were collected 48 h after transfection ...
-
bioRxiv - Physiology 2022Quote: ... The samples were combined with 1 ml of 3:13 dilution of Erlich’s reagent [1.5 g of 4- (dimethylamino) benzaldehyde (ThermoFisher); 5 ml ethanol ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5(6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA; CA-DCF-DA; (C400, ThermoFisher Scientific)) at a stock concentration of 20 mM in DMSO was diluted in DMEM without phenol red to a concentration of 40 μM ...
-
bioRxiv - Immunology 2021Quote: C-LP cells pooled from 5-7 mice were sorted into TriZol® (Thermo Fisher) and cDNA was generated by using QuantiTect Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... Cultures were passaged as aggregates every 5-7 days using a collagenase IV solution (Gibco) to detach hESC colonies ...