Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 7 HYDROXY 5 METHYL 1 3 4 TRIAZAINDOLIZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... plates were treated with 2 μM of the CellEvent™Caspase-3/7 green detection reagent (Life Technologies, UK) for 60 minutes at 37 °C in the dark ...
-
Multi-Omic Analysis Reveals Disruption of Cholesterol Homeostasis by Cannabidiol in Human Cell LinesbioRxiv - Systems Biology 2021Quote: ... seeded with 2,000 cells/well and stained with Hoescht 33258 (1µg/mL) and CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) at a dilution of 1000x ...
-
bioRxiv - Cell Biology 2022Quote: ... 2007) and DsRed2-Mito (Tanaka Bio) plasmids using a ratio of 7:3 using Lipofectamine LTX Plus (ThermoFisher, 15338100) for 5 hours ...
-
bioRxiv - Biophysics 2022Quote: ... 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-ATTO647N (ATTO-lipid) and (iii) 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-Cyanine 7 (Cy7-lipid) were from Invitrogen, ATTO-TEC and Avanti Polar Lipids ...
-
bioRxiv - Cancer Biology 2023Quote: A549 cells grown in 96-well plates were stained with CellEvent Caspase 3/7 green detection reagent (Thermo Scientific) according to manufacturer’s instructions and the fluorescence measured using a plate reader at 488 nm wavelength ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell proliferation was monitored every 24 or 72 hr for 3-7 consecutive days using CyQuant Reagent (Invitrogen, C35011) by measuring bottom-read fluorescence at 520 nm with excitation wavelength set at 480 nm using EnSight Multimode Plate Reader (PerkinElmer) ...
-
bioRxiv - Cell Biology 2020Quote: ... 7- Amino-4-Chlormethylcumarin (CMAC) was part of the Yeast Vacuole Marker Sampler Kit (Y7531) from Thermo Fisher and staining was performed according to manufacturer recommendations ...
-
bioRxiv - Bioengineering 2022Quote: ... were used for experiments in passage 4 to 7 and were cultivated in Dulbecco’s Modified Eagle’s Medium (DMEM, Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Physiology 2022Quote: ... the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; 6.83 μg/kg BW, Invitrogen) dissolved in 50% dextrose (1 g/kg BW ...
-
bioRxiv - Immunology 2020Quote: ... polyclonal CD8+ T cells were labelled with 20 μM CellTracker™Blue CMAC (7-amino-4-chloromethylcoumarin; Invitrogen) for 20-30 min at 37° C ...
-
bioRxiv - Systems Biology 2022Quote: ... 4 × 108 cells per biological replicate were used after 7 days of blasticidin selection (10 mg/mL, Gibco), which was 9 days post-infection ...
-
bioRxiv - Cell Biology 2023Quote: ... HSPCs were incubated with 20µM NBD C6-Ceramide (6-((N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)amino)hexanoyl)Sphingosine) (Invitrogen) for 30 minutes at 4°C for Golgi staining or Cytopainter (Abcam ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then incubated for 30min at 37°C with 150µM of 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (ThermoFisher).
-
bioRxiv - Bioengineering 2024Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, Cat # N13195) and incubated for 30 minutes in their respective culture conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then resuspended in aCSF and incubated with DAPI (1:1000 dilution of 1mg/mL DAPI, Thermo Fisher, #62248 or 7-AAD 7-Aminoactinomycin D, A1310, Thermo Fisher) for FACS sorting ...
-
bioRxiv - Microbiology 2020Quote: The ΔΨ component was measured using tetramethylrhodamine methyl ester (Invitrogen) as described previously14 ...
-
bioRxiv - Physiology 2020Quote: ... Sections were stained with BODIPY TR methyl ester (Thermo Fisher) diluted 1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were washed at least 5 times 20 min and transferred to 0.25% PBT with 1:400 TO-PRO-3 (ThermoFisher #T3605) for 2 nights ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were washed 3 x 5 min with PBS before adding secondary antibody (1:200 Alexafluor-488 goat anti-mouse, Invitrogen) and rhodamine phalloidin (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Then slides were washed 3×5’ in TBS and incubated in donkey-α-sheep-488 (1:500, Life Technologies, A11015) in TBS for 90’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were then washed with PBS-T (3 × 5 min) and incubated with fluorophore-conjugated secondary antibodies (1:500 in blocking buffer, Invitrogen). Hoechst 33258 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was washed 3 times with 5% milk TBST and incubated with HRP-conjugated secondary antibodies (1:5000, 32230/32260; Invitrogen). Data were visualized using chemiluminescence detection on ChemiDoc Touch (Bio-Rad Laboratories).
-
bioRxiv - Bioengineering 2023Quote: ... KTB21 human mammary basal epithelial cell line was cultured in epithelial cell growth medium (DMEM [low glucose]: Ham’s F12 [1:3] medium supplemented with 5% FBS [Thermo Fisher Scientific] ...
-
bioRxiv - Developmental Biology 2023Quote: ... Stained samples were washed (3 x 5 minutes) and incubated in DAPI solution (Invitrogen, D3571; diluted 1:1000 in DPBS) for 10 minutes at room temperature ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation, Oregon, USA) followed by washing with 1x DPBS (nuclei data not shown) ...
-
bioRxiv - Cell Biology 2023Quote: ... the iMACs were washed 3 x 5 min with PBS and incubated for 1h with 1:1000 goat anti-mouse IgG-AF488 (A11001, Invitrogen). Afterwards the cells were again washed 3 x 5 min with PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1μl of oligo-dT30VN primer (10 μM 5’-aagcagtggttatcaacgcagagtact30vn-3’) and 1 μl of 10 mM dNTP mix (Thermo Fisher). Illumina libraries were prepared by using a modified smart-seq2 protocol [Picelli 2014] using SuperScript IV RT and tagmentation procedure as previously described [Henning 2018] ...
-
bioRxiv - Neuroscience 2024Quote: ... The following day the sections were washed 3 times for 5 min each in PBS-T and incubated with the corresponding secondary antibodies (all 1:1000, Invitrogen), for 2 h at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... Supernatant (1 ml at ~4-5 mg/ml) was incubated with 50 μl of superparamagnetic Dynabeads Streptavidin C1 (Invitrogen) and rotated overnight at 4 °C ...
-
bioRxiv - Genomics 2020Quote: ... 5 mM MgCl2, 1 mM EGTA, 0.5 mM DTT, 0.05% Tween-20, 4 U/mL SUPERase-In [Thermo Fisher] ...
-
bioRxiv - Microbiology 2020Quote: ... Cell envelopes were stained by adding 5 µL of 1 mg/mL FM™ 4-64FX (Thermo Fisher Scientific) and non-viable cells stained with 1 µL of the LIVE/DEAD™ cell dye (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with primary antibody O/N at 4°C (5% FBS, 0.5% Tx, 0.2% gelatine in PBS; GFP (1:500, ThermoFisher Scientific). Slices were then repeatedly washed with PBS-0.5% Tx ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Microbiology 2024Quote: ... were then mixed 1:1,000 with 5 mL of MMB agar + Tetracycline and poured into 4-well Nunc Rectangular Dishes (ThermoFisher). Dishes were dried at room temperature for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... For cell viability assays 7-AAD (7-Aminoactinomycin D, Invitrogen, A1310) and Hoechst 33342 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: To generate construct drg1 [prab-3∷GCaMP6m∷NLS∷unc-54 3’UTR] we performed a 4-way Gateway recombination reaction using LR Clonase II (Invitrogen). We recombined pDEST II with the following entry clones ...
-
bioRxiv - Microbiology 2020Quote: ... The purified linearized vector and digested foxA gene were ligated (1:3 molar ratio) overnight at 4°C using T4 DNA ligase (Thermo Scientific). The construct was transformed into competent E ...
-
bioRxiv - Neuroscience 2020Quote: ... Slices were then rinsed 4 x 15 min in PBS using the nuclear counterstain TO-PRO-3 Iodide (1:2000, Thermo Fisher). For preservation of immunofluorescence ...
-
bioRxiv - Bioengineering 2020Quote: ... We performed ERBB2 SNAPD on a 9:1 mixture of MOLT-4 and SK-BR-3 cells stained with CellTrace™ Calcein Red-Orange AM (Invitrogen). We then reinjected these droplets onto a dielectric sorting device (Fig ...
-
bioRxiv - Cancer Biology 2020Quote: ... The medium was changed every 2-3 days and organoids were passaged every 2-4 weeks by dissociation with 1 ml of TrypLE Express (Life Technologies) at 37°C for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... CAT-1 (encoded by SLC7A1) and CAT-3 (encoded by SLC7A3) had 4 substrates including L-Lysine hydrochloride (Fisher Scientific #BP386), L-Histidine (Sigma-Aldrich #H6034) ...
-
bioRxiv - Immunology 2021Quote: ... PBMCs were incubated for 20 min at 37°C in PBS containing 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16; 1 μM; Thermo Fisher Scientific). To determine neutral lipid content ...
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was stained using 4’,6-diamidino-2- phenylindole (DAPI) diluted 1:10000 in PBS containing 3% BSA (Molecular Probes) to illuminate host cell nuclei ...
-
bioRxiv - Developmental Biology 2022Quote: ... Table 2) incubated for 3 overnights at 4 °C in blocking buffer with Alexa-dye conjugated secondary antibodies (1:500, Molecular Probes) incubated for 1 overnight at 4 °C in blocking buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-phosphohistone 3 (1:100, Invitrogen), anti-phosphoAMPK (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... TOTO-3 iodide (1/2000, Invitrogen) was added to the secondary antibody solution to label cell nuclei (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... 1/3 Neurobasal (Thermo Fisher Scientific), 1x N-2 Supplement (Thermo Fisher Scientific) ...