Labshake search
Citations for Thermo Fisher :
601 - 650 of 10000+ citations for 7 Bromo 5 fluoro 3 methyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative PCR was performed using SYBR green reagents on an Applied Biosystems QuantStudio 3 and ViiA 7 Real-Time PCR Systems (ThermoFisher).
-
bioRxiv - Cell Biology 2020Quote: ... FACS analysis of transfected BEAS-2B cells for caspase 3 & caspase 7 along with SYTOX AADvancedTM Dead Cell Stain was performed per manufacturer’s protocol (Thermo Scientific).
-
bioRxiv - Physiology 2021Quote: ... JC-1 dye was added 10 min prior to recording (ex.488/em.535 and em.590) while CellEvent Caspase 3/7 (ThermoFisher) was added immediately prior to recording (ex.495/em.540).
-
bioRxiv - Immunology 2021Quote: ... NKp46+ and stained as indicated by manufacturer’s protocol with Cell Event Caspase 3/7 Green Flow Cytometry Assay Kit (Molecular Probes). All samples were analyzed using BD Canto FACS instrument ((BD Biosciences ...
-
bioRxiv - Genomics 2021Quote: ... Apoptosis staining was performed using the CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific, Waltham, MA). Stained cell suspensions were measured with the BD LSRFortessa Cell Analyzer (BD Biosciences ...
-
bioRxiv - Microbiology 2022Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (C10723) and PrestoBlue™ Cell Viability Reagent (A13261) were purchased from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... the COS-7 cells were transfected with plasmids encoding tubulin (3×mEmerald-ensconsin) and ER (mCherry-KDEL) by using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol17 ...
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated with a dye master mix containing CellEventTM Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific, 1:1000) and Zombie NIR fixable viability stain (BioLegend ...
-
bioRxiv - Cancer Biology 2024Quote: ... the media was replaced with DMEM + 10% FBS + CellEvent Caspase-3/7 Detection Reagent (Green) according to the manufacturers recommendations (Invitrogen). The plate was then imaged every 15 minutes using phase and GFP channels in the ZEISS Celldiscoverer 7 Automated Live Cell Imager set to 42°C at 5% CO2 and 20% O2 ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Cell Biology 2021Quote: ... inverted and incubated with fluoro-Ruby-Dextran (1:100 of 100 mg/ml stock; 10,000 MW; Invitrogen CA) in Graces medium for 10 min ...
-
bioRxiv - Biophysics 2021Quote: ... and DRAQ-7 (Thermofisher) was administered at 1:100 ratio to every sample droplet and the Petri dish was stored at room temperature for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... KLRG1 (PeCyanine 7, Invitrogen, FITC ...
-
bioRxiv - Bioengineering 2020Quote: ... 7-AAD stain (Invitrogen) was added to each sample (2.5 μL per well in the 96-well plate ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pH = 7 (Invitrogen™) and at -30°C ...
-
bioRxiv - Biophysics 2021Quote: ... Methyl-PEG4-thiol (MT(PEG)4) was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... incubated with 200 nM tetramethylrhodamine methyl ester (TMRM) (Invitrogen, Milan, Italy) for 10 minutes at 37°C and immediately measured on a FacsCalibur flow cytometer (Becton Dickinson ...
-
bioRxiv - Developmental Biology 2022Quote: ... 80□μL of N-methyl-N-(trimethylsilyl) trifluoroacetamide□(Thermo Fisher Scientific) and 70□μL ethyl acetate (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... and Methyl-PEG-Maleimide Reagent (MM(PEG)24) (Thermo Fisher, 22713). NEM was added to Chlamydomonas cultures growing as indicated in each case to a final concentration of 10 mM ...
-
bioRxiv - Biochemistry 2023Quote: ... methyl tert-butyl ether and 2-propanol were from Thermo Fisher Scientific (Pittsburg ...
-
bioRxiv - Cell Biology 2023Quote: Mitochondrial membrane potential was determined using tetramethylrhodamine methyl ester (TMRM) (Invitrogen). Cells were plated in 12-well plates and transfected with the indicated siRNAs for the indicated times ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3x with M9 and incubated for 1h in 0.2% DiI (Invitrogen) in M9 ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated for 1h with Streptavidin-Cy5 (SA1011, Thermo Fisher Scientific), diluted 1:500 in TNB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Following 1h incubation with Alexa Fluor-conjugated secondary antibodies (1:1000, ThermoFisher) and Texas Red- or Alexa Fluor 488-conjugated Phalloidin (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1H was performed using an Applied Biosystems 7500 Fast (Thermo Fisher Scientific) with an Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... then loaded with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethylester (BCECF-AM, 1.6 μM, Life Technologies) for 30 min at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Three tadpoles per stage (1, 2, 5, 7, and 8 weeks after hatching) were fixed in an RNAlater (Ambion) solution ...
-
bioRxiv - Physiology 2019Quote: ... 10 μm thickness muscle cryosections were incubated with 5 μM of 2’,7’-dichlorodihydrofluorescein diacetate (DCFH; Molecular Probes, Eugene) and allowed to dry overnight at room temperature in dark ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Liver-Chips were stained in the upper channel with 5(6)-Carboxy-2′,7′-dichlorofluorescein diacetate (CDFDA) (Thermo Fisher) to visualize bile canaliculi and MRP2 activity ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were then plated at 1.6 × 106 cells per 6-well and allowed to differentiate for 5-7 days in RPMI-1640 medium (GIBCO), 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Microbiology 2020Quote: ... Huh-7 .5 and BHK-21 cells were cultured in Dulbecco’s minimal essential medium (DMEM) (Gibco /Thermo Fisher Scientific) supplemented with 2mM L-glutamine (Gibco /Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Huh-7 .5 and BHK-21 cells were cultured in Dulbecco’s minimal essential medium (DMEM) (Gibco /Thermo Fisher Scientific) supplemented with 2mM L-glutamine (Gibco /Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... for 30 min followed by glycerol in PBS (volume ratio 7:3) for 30 min before being mounted onto superfrost slides (Fisher Scientific) for imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... CS03iCTRn2 hPSCs were dissociated with Versene and colonies were transferred to an ultra-low attachment T-25 flask containing EZ sphere culture medium (a mixture of DMEM and F-12 medium in a 7:3 ratio supplemented with 1× B-27 supplement minus vitamin A [Life Technologies] ...
-
bioRxiv - Neuroscience 2022Quote: ... the percentage of apoptotic astrocytes was evaluated using CellEvent Caspase-3/7 Green Detection Reagent (1:250; Thermo Fisher, cat. #C10423) added directly to the medium ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were then resuspended in DMEM + 10% FBS supplemented with 50 μM CellEvent™ Caspase 3/7 Green Detection Reagent (Invitrogen) at 37 °C for 25 min ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: ... A pre-warmed buffer containing DPBS supplemented with 10% FBS and CellEvent Caspase 3/7 Green (1 μL/1 mL of buffer; ThermoFisher C10427) were added to the cells ...
-
bioRxiv - Genomics 2020Quote: ... 4 μM glass slide) then for Laser Capture Microdissection (LCM; N=3; 7 μM glass slide coated with polyethylene naphthalate – ThermoFisher #LCM0522). The slides were stored at −20°C in an airtight container with desiccant until ready for dissection (1 day to 3 months) ...