Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 7 Bromo 5 fluoro 3 methyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: A549 cells grown in 96-well plates were stained with CellEvent Caspase 3/7 green detection reagent (Thermo Scientific) according to manufacturer’s instructions and the fluorescence measured using a plate reader at 488 nm wavelength ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell proliferation was monitored every 24 or 72 hr for 3-7 consecutive days using CyQuant Reagent (Invitrogen, C35011) by measuring bottom-read fluorescence at 520 nm with excitation wavelength set at 480 nm using EnSight Multimode Plate Reader (PerkinElmer) ...
-
bioRxiv - Microbiology 2020Quote: The ΔΨ component was measured using tetramethylrhodamine methyl ester (Invitrogen) as described previously14 ...
-
bioRxiv - Molecular Biology 2021Quote: ... BODIPY TR methyl ester (1:300, Life Technologies, Darmstadt, Germany) or Vybrant DiO (1:200 ...
-
bioRxiv - Physiology 2020Quote: ... Sections were stained with BODIPY TR methyl ester (Thermo Fisher) diluted 1:200 ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by 1h incubation with AF488-conjugated secondary antibody (A21202, Invitrogen). Cell samples were mounted in SlowFade Gold Antifade Mountant with DAPI (S36938 ...
-
bioRxiv - Biochemistry 2021Quote: ... membranes were blocked for 1h with 2% I-Block (Thermo Fisher) prior to immuno-detection with mouse anti-GFP (UC Davis/NIH Neuromab Facility ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... were incubated for 1h in LysoTracker Red DND-99 reagent (Invitrogen) 75nM concentration and for 30 min in 1X tubulin tracker deep red reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... and stained for 1h with an anti-GFP antibody (A10262, Invitrogen). Wells were washed three times with PBS and incubated with an anti-chicken Alexa Fluor 488 coupled secondary antibody (A11039 ...
-
bioRxiv - Neuroscience 2023Quote: ... for 1h and blocked with 10% normal goat serum (10000C, Invitrogen) and 0.25% Triton X-100 for 1 h ...
-
bioRxiv - Physiology 2021Quote: ... and incubated with secondary antibody (conjugated goat anti-rat Alexa fluoro 546, 1:1,000 dilution, A11081; Invitrogen by ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were processed using the Click-iT™ EdU Alexa Fluoro™ 647 imaging Kit (Thermo Fisher) following the manufacturer’s protocol.
-
bioRxiv - Biophysics 2023Quote: ... 100 nm diameter blue beads with an excitation wavelength (λex) of 450 nm (Fluoro-Max; Fisher Scientific), 100 nm diameter yellow bead ...
-
bioRxiv - Biophysics 2023Quote: For point spread function evaluation a sample of 500 nm microbeads (Thermo Scientific Fluoro-Max green G500) was used ...
-
bioRxiv - Physiology 2023Quote: ... For cell viability assays 7-AAD (7-Aminoactinomycin D, Invitrogen, A1310) and Hoechst 33342 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Immunology 2020Quote: ... 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB (Thermo Fisher Scientific; (Bruner et al., 2016)) ...
-
bioRxiv - Immunology 2020Quote: ... 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB (Thermo Fisher Scientific; (Schmid et al., 2010)).
-
bioRxiv - Genetics 2019Quote: ... 5’-6FAM-CTC AGA CCA GCT GAA G-MGB-3’ (Life Technologies). DENV-1 KDH0026A ...
-
bioRxiv - Microbiology 2021Quote: ... Sections were cut at 3-5 μm on a cryotome (ThermoFisher Scientific) using C35 carbon steel blades (Feather ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each reaction and incubated for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell pellet was suspended in 3-5 ml TrypLE Express (ThermoFisher, 12605028) depending on the pellet volume and incubated at 37°C for 10-15 min with mixing every 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 10% (for RS-5) or 20% (for DM-3) FBS (Gibco). All the other cells were cultured in RPMI medium (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged every 3-5 days using Trypsin-EDTA (Gibco, 25200056). All experiments were done with cells at 10 passages or earlier with regular testing for mycoplasma ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-ATTTGTCGACTCATTCTAATCCTTCGTCTTTTGATT-3′ by using Phusion high-fidelity DNA polymerase (Thermo Scientific) and cDNA prepared from the parasites as template ...
-
bioRxiv - Cell Biology 2020Quote: ... were transfected with human myosin VI siRNA duplex (5′GGUUUAGGUGUUAAUGAAGtt-3′) (Ambion) or AllStars Negative Control siRNA duplex (Qiagen ...
-
bioRxiv - Biophysics 2021Quote: ... LUVs were prepared using sonication (Fisher Scientific, Ultrasonic Bath, 3 × 5 min). Sonication was performed in ice water bath ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each sample and incubated for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... TOGARAM1 was depleted using siRNA with sequence 5′-CCUCGUAAUUCCUUAGAAA-3′ (Thermo Scientific) Cells were seeded onto coverslips at 70% confluency and transfected with 50 nM of siRNA in two sequential transfections using Lipofectamine RNAiMAX (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... ID: s2513 (Silencer Select Validated; 5’-GA UAUACCCUGGAAAGUCUtt-3’) (Thermo Fisher Scientific) with JetPrime (Polyplus ...
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cells (ATCC) were grown at 37°C with 5% CO2 in Dulbecco’s modified Eagle’s medium (Gibco) containing 10% fetal bovine serum and 1% penicillin/streptomycin (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl of 7-amino-actinomycin D (7AAD, 50 μg/ml working solution in PBS, Thermo Fisher Scientific) was added to the stained cells 5–10 min before measurement.
-
bioRxiv - Microbiology 2022Quote: ... infected Jurkat cells were initially preloaded with 5 µM of CellTracker CMAC (7-amino-4-chloromethylcoumarin) (Life Technologies) and cocultured for 6 or 24 h with MDMs plated onto coverslips ...
-
bioRxiv - Cell Biology 2022Quote: ... and cultured for 5-7 days at P0 before been passaged with Tryspin - EDTA 0.05% (Thermo Scientific, 25300054). Cells were passaged every 4-5 days and until p8 ...
-
bioRxiv - Neuroscience 2021Quote: ... Pipettes had resistances of 5–7 MΩ when filled with this solution supplemented with Fura-2 (Molecular Probes). Recordings were made using a Multiclamp 700B amplifier (Molecular Devices ...
-
bioRxiv - Bioengineering 2020Quote: ... WT-PGP1 were labeled with 5 μM CellTracker™ Blue 7-amino-4-chloromethylcoumarin CMAC (Molecular Probes, #C2110), iNeuron-PGP1 was labeled with 2.5 μM CellTracker™ Green CMFDA (Molecular Probes ...
-
bioRxiv - Cell Biology 2022Quote: WT organoids passage 10 were collected 5-7 days after passaging and digested with TrypLE (Thermo Fisher Scientific) for 20 min at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa and COS-7 cells were seeded onto dishes coated with 5 mg fibronectin (Life Technologies 33016-015) in diH2O ...
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
bioRxiv - Cell Biology 2019Quote: ... 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA),3,3’-dihexyloxacarbocyanine iodide [DiOC6(3)] and N-[4-[6-[(acetyloxy)methoxy]-2,7-difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxoethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxoethyl]-,(acetyloxy)methyl ester (Fluo-4 AM) were purchased from Molecular Probes (Invitrogen, Eugene, OR, USA). Agarose was obtained from Lonza (Walkersville ...
-
bioRxiv - Immunology 2021Quote: ... To obtain Mfs purified monocytes were plated on 24 well plates 3 × 105 cells/well and cultured for 7 days in Macrophage-SFM (Gibco, Life Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... Replicates of hiPSC-derived neurons were harvested at three different timepoints of differentiation (days 1, 3, and 7) with 200 µl Trizol (Invitrogen) per sample and stored at −80 °C until sequencing ...
-
bioRxiv - Bioengineering 2020Quote: Total RNA was extracted from HTM cells ± DEX at 7 d (N = 3 per group and donor) using PureLink RNA Mini Kit (Invitrogen). RNA concentration was determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell death was assessed by measuring caspase 3 cleavage using a CellEvent Caspase3/7 Green Flow Cytometry kit (Thermo Fisher), according to the manufacturer’s descriptions ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissues were then digested in room temperature for 7 min in a 3-mL Hank’s solution containing 0.25% Trypsin (Thermo Fisher, 15090046) and 0.1 μg/μL DNase (Sigma D5025 ...
-
bioRxiv - Cancer Biology 2022Quote: mScarlet-fascin/fascin KD or mScarlet/fascin KD HeLa cells were plated with 2 mM CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) in CellCarrier Ultra 384 well plates (PerkinElmer ...
-
bioRxiv - Zoology 2022Quote: ... 2.3 × 105 Huh-7 cells were transfected with 2 µg of pSpCas9-BB-2A-GFP-sgPURA using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions ...