Labshake search
Citations for Thermo Fisher :
801 - 850 of 10000+ citations for 7 Bromo 5 fluoro 3 methyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: 22-(N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)Amino)-23,24-Bisnor-5-Cholen-3β-Ol-cholesterol (22-NBD-cholesterol) (N1148) and 7-NBD-PE (N360) were obtained from Thermo Fisher and dissolved in ethanol at 1 mM ...
-
bioRxiv - Microbiology 2023Quote: Real-time PCR was performed by standard TaqMan Assay on either the QuantStudio 7 or Quantstudio 5 Real-Time PCR platform (Applied Biosystems). Briefly ...
-
Machine Learning Ensemble Directed Engineering of Genetically Encoded Fluorescent Calcium IndicatorsbioRxiv - Bioengineering 2023Quote: ... Cells were washed 2x by spinning at 0.7 rcf for 5 minutes at room temperature and removing supernatant + resuspending in 10 mLs of Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: For detection of NO in treated mycobacteria DAF-FM diacetate (4-Amino-5-Methylamino-2’,7’-Difluorofluorescein),27 purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The medium was changed every day and cells were passaged at 70%-80% confluency every 5-7 days using PBSCa-/Mg- (Life Technologies; Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: qPCR was performed with 2.5 ng of DNA in triplicates using PowerSYBR Green PCR master mix at Quant Studio 7 qPCR machine (both Applied Biosystems) according to the manufacturer ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were washed 2x by spinning at 0.7 rcf for 5 minutes at room temperature and removing supernatant + resuspending in 10 mLs of Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: 7 μM Aβ40 was incubated with varying stoichiometries of claramine and 5% PEG (50% w/w 10 kDa, Thermo Fisher Scientific) in the presence of 20 mM ThT (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were washed 2x by spinning at 0.7 rcf for 5 minutes at room temperature and removing supernatant + resuspending in 10 mLs of Neuronal Basal Media (Invitrogen; 10888022) supplemented with B27 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... the conversion of non-fluorescent 2’,7’-bis-(2- carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF AM) (Invitrogen, Waltham, MA) into a pH sensitive fluorescent indicator by the intracellular esterase was used to measure the pH ...
-
bioRxiv - Cell Biology 2024Quote: COS-7 cells were grown at 37°C with 5% CO2 in complete Dulbecco’s Modified Eagle’s Medium (DMEM) (Thermo Fisher Scientific, USA) containing 10% FBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific, Thermo Fisher Scientific) and dried ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific, Thermo Fisher Scientific) and dried ...
-
bioRxiv - Biochemistry 2021Quote: ... Fluorescence-labelled 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (NBD-PE) was obtained from Molecular Probes (Eugene, Oregon, US). Sucrose was purchased from XiLong Chemical Co. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3) and four tyr (clutch no. 7) mutants using the Invitrogen TOPO TA kit according to the manufactures protocol (Invitrogen catalogue no. K4575J10), and Sanger sequenced the extracted plasmids from 6-10 colonies per embryo (Fig ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Bioengineering 2023Quote: The number of epithelial cells in the Cervix Chip was obtained by digesting the Cervix Chip apical channel at day 7 of differentiation or day 3 on co-culture with bacteria with Collagenase IV (Gibco, Cat. No. 17104019) in TrypLE (Thermo Fisher ...
-
bioRxiv - Cell Biology 2019Quote: ... HRP-conjugated secondary antibodies were incubated for 1h before visualisation using ECL (ThermoFisher #34096)
-
bioRxiv - Bioengineering 2020Quote: ... for 1h at room temperature and embedded in HistoGel Specimen Processing Gel (Thermo Fisher) prior to paraffin processing ...
-
bioRxiv - Cancer Biology 2020Quote: ... mitochondria were stained for 1h with 200nM MitoTracker Deep Red (M22426, Thermo Fisher Scientific). After ...
-
bioRxiv - Neuroscience 2020Quote: ... and then 1h incubation in streptavidin-Alexa 568 conjugate Alexa 647-conjugate (Thermo Fisher Scientific Cat# S-21374 ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-rabbit Alexa Fluor 488-conjugated secondary antibody (1:200, 1h, Invitrogen #A11070), goat anti-mouse Alexa Fluor 488-conjugated secondary antibody (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-mouse Alexa Fluor 488-conjugated secondary antibody (1:200, 1h, Invitrogen #A21235), phalloidin Texas red (1:100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Membranes were incubated for 1h at RT with fluorescent streptavidin (1:10000, Invitrogen, #S11378) diluted in 2% (w/v ...
-
bioRxiv - Molecular Biology 2022Quote: ... then for 1h at RT with prepared dynabeads sheep anti rabbit IgG (Invitrogen, #11203D). Coprecipiate was washed once with wash buffer (polysomal buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated for 1h at 25°C in Alexa Fluor® 647 (Invitrogen) goat anti-rabbit secondary antibody (1:500 in 1% BSA-TBS).
-
bioRxiv - Microbiology 2024Quote: ... primary antibody for 1h followed by Alexa Fluor secondary antibody (1:1000; Life Technologies) for 1 h to label the CCV ...
-
bioRxiv - Neuroscience 2021Quote: ... Fly brains were incubated with 100 nM Tetramethylrhodamine methyl ester (TMRM) (Invitrogen, I34361) for 30 min at 37 °C and washed three times with Hank’s balanced salt solution (HBSS) ...
-
bioRxiv - Neuroscience 2019Quote: ... The co-cultures were stained with tetramethylrhodamine methyl ester (TMRM, Invitrogen; 250 nM) for 45 min at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were loaded with 10 nM Tetramethyl Rhodamine Methyl Ester (TMRM) (Molecular Probes) and incubated at 37°C for 30 min ...
-
bioRxiv - Genomics 2020Quote: ... and the mitochondria-specific dye tetramethylrhodamine methyl ester (TMRM, 25nM; Thermo Fisher Scientific) diluted in Hanks solution (Gibco ...
-
SMDT1 variants impair EMRE-mediated mitochondrial calcium uptake in patients with muscle involvementbioRxiv - Genetics 2022Quote: ... Cells were incubated with 15 nM tetramethyl rhodamine methyl ester (TMRM; #T668; Invitrogen) in culture medium for 25 min at 37°C and 5% CO2 in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... FM4-64 and leucyl-L-leucine methyl ester (LLOMe) were from Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... and subsequently alkylated with 50 mM S-methyl methanethiosulfonate (MMTS) (Thermo Fisher Scientific) in USS for 1 h at room temperature ...
-
TNFR1/p38αMAPK signaling in Nex+ supraspinal neurons regulates sex-specific chronic neuropathic painbioRxiv - Neuroscience 2023Quote: ... N-methyl-D-aspartate receptor 1 (NMDAR1, rabbit, 1:1000, Invitrogen PA5-34599), N-methyl-D-aspartate receptor 2B (NMDAR2B ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
bioRxiv - Systems Biology 2019Quote: ... 5’-ACG UGA CAC GUU CGG AGA Att-3’) by Lipofectamine 2000 (Thermo Fisher, #11668019) 48 hr before performing experiment.
-
bioRxiv - Cell Biology 2019Quote: ... CAP-D3 (5-CAUGGAUCUAUGGAGAGUATT-3)29 and control15 were transfected using Oligofectamine transfection reagent (Invitrogen) according to the manufacturer’s instructions and analysed 48h after transfection ...
-
bioRxiv - Genetics 2019Quote: ... 5’ -6FAM CTC AGA GAC ATA TCA AAG ATT CCA GGG-MGB-3’ (Life Technologies). Viral load is expressed on a Log10 scale as viral genome copies per milliliter (plasma samples ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Cell Biology 2019Quote: ... for 5 min and separated on a 3-8% tris-acetate gel (ThermoFisher Scientific; EA0375BOX). Following electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: ... Primer 2: 5’-GGATGTTCGTCCAGTGAGATTAG-3’) using a 7500 Fast Real-Time PCR System (Applied Biosystems) and accompanying software to analyze qPCR data.
-
bioRxiv - Synthetic Biology 2019Quote: ... and MIT_v2.1_SbfInifJ_RV2 5’-AACCTGCAGGGCTAACTAACTAACCACGGACAAAAAACC-3’) and ligated into pCR Blunt II TOPO (Thermo Fisher Scientific). The second half containing nifBQFUSVWZM was amplified with SbfI sites on either end (with oligos MIT_v2.1_SbfInifB_FW 5’-AACCTGCAGGTACTCTAACCCCATCGGCCGTCTTA-3’ ...
-
bioRxiv - Developmental Biology 2019Quote: For live imaging 3-5 day old flies were dissected in Schneider’s Insect Media (Thermofisher) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...