Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 7 Bromo 5 fluoro 3 methyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... follicles were incubated with 500 nM CellEvent™ Caspase-3/7 Green Detection Reagent (C10427, Invitrogen). Oocytes were stained with 150 nM Sir-Tubulin (CY-SC002 ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissues were washed with PBS and incubated in Alexa Fluoro 488 and 647 (Invitrogen) concurrently in blocking solution for two hours at room temperature in a darkened chamber ...
-
bioRxiv - Neuroscience 2021Quote: ... unilateral injections of 50-80nl of the retrograde neuronal tracer Fluoro-Gold (Molecular Probes, Eugene ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The gels were mounted on fluoro-dishes using ProLong Gold Antifade Mountant (ThermoFisher Scientific). Samples were imaged using a Nikon A1+ confocal microscope equipped with DU4 detector ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary antibody incubation with anti-rabbit-HRP and anti-mouse-HRP was done at room temperature for 1h in 5% milk in TBS-T and the signal developed using an ECL mixture (Life Technologies, 32132). For a detailed list of antibodies see Supplementary Table 2 ...
-
bioRxiv - Cancer Biology 2023Quote: 250’000 Jurkat cells or purified T cells were seeded onto a 24-well plate and transduced at an MOI of 5 via spin-infection for 1h at 800xg and 32°C in 450 µl RPMI-1640 medium (Gibco, #42401-018) containing 50 µl of 100-fold concentrated lentiviruses ...
-
bioRxiv - Immunology 2022Quote: ... and 250nM tetramethyl rhodamine methyl ester (TMRM, ThermoFisher) for 30 minutes at 37°C prior to extracellular staining and flow cytometry ...
-
bioRxiv - Immunology 2024Quote: ... 100 nM tetramethylrhodamine methyl ester (TMRM, ThermoFisher Scientific). 500 nM CellROX or 1 μM MitoSOX in HBSS at 37°C for 20 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5(6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA; CA-DCF-DA; (C400, ThermoFisher Scientific)) at a stock concentration of 20 mM in DMSO was diluted in DMEM without phenol red to a concentration of 40 μM ...
-
bioRxiv - Immunology 2021Quote: C-LP cells pooled from 5-7 mice were sorted into TriZol® (Thermo Fisher) and cDNA was generated by using QuantiTect Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-7 μg BACMID DNA was incubated with 4 μL Fugene (Thermo Fisher, Cat# 10362100) in 200 μL of ESF 921 media for 30 minutes at 23°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Cultures were passaged as aggregates every 5-7 days using a collagenase IV solution (Gibco) to detach hESC colonies ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were passaged once every 5-7 days using 0.5 mM EDTA (Life Technologies, #AM9260G) in phosphate-buffered saline (PBS)-/- (Life Technologies ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR was performed with Scientific QuantStudio 5 and 7 Real-Time PCR System (Thermo Fisher) using the DyNAmo Color Flash SYBR Green Mix (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged once every 5-7 days using 0.5 mM EDTA (Life Technologies, #AM9260G) in PBS-/- (Life Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: The 2′ O-methyl phosphorothioate AOs were transfected into dermal fibroblasts as lipoplexes using 3 μl of Lipofectamine 3000 (Life Technologies, Melbourne, Australia) per 1 ml of OptiMEM ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated for 1h with secondary antibodies (Invitrogen). Afterwards ...
-
bioRxiv - Neuroscience 2022Quote: ... or 1h with 10% normal goat serum (Gibco BRL) and 0,4% Triton X-100 (for PLP) ...
-
bioRxiv - Cell Biology 2021Quote: ... phalloidin Texas red (1:100, 1h, Life technologies #T7471) and anti-alpha-Tubulin-FITC (1:200 ...
-
bioRxiv - Microbiology 2020Quote: ... The modified nucleotide 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated by PCR using DreamTaq™ DNA Polymerase (Thermo Scientific™) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 7-AAD (7-Aminoactinomycin D) (Thermofisher, # A1310) was used for DNA staining ...
-
bioRxiv - Microbiology 2019Quote: ... Caspase-like activity was measure with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen), a nucleic acid-binding dye that harbors the caspase-3/7 cleavage sequence ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then resuspended in 10 µM CellEvent Caspase 3/7 activity reporter in PBS (Invitrogen, #C10723) and incubated for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were passaged every 3-7 days as single cells using TrypLE™ Select CTS™ (Gibco). The ROCK inhibitor Y27632 (Fujifilm ...
-
bioRxiv - Microbiology 2020Quote: ... For detection of effector caspase activity 20 µM CellEvent Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific) was added to the infected cells prior to imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... Taqman® assays (Supplementary table 3) and QuantStudio™ 7 Flex Real Time PCR system (ThermoFisher, USA), and relative expression levels determined using QuantStudio™ 7 Real Time PCR software.
-
bioRxiv - Neuroscience 2019Quote: ... unc-7 rescue plasmids were made using the Multisite Gateway® 3-Fragment Vector Construction Kit (Invitrogen). A 1078bp mec-4 promoter fragment (as previously used ...
-
bioRxiv - Cell Biology 2021Quote: ... MEF cells were supplemented with CellEvent™ Caspase-3/7 green detection reagent (Life Technologies, Darmstadt, Germany) following manufacturer’s instructions before aldehyde fixation ...
-
bioRxiv - Neuroscience 2023Quote: ... 30 microliters of the apoptosis detection reagent (CellEvent™ Caspase-3/7 Green Detection Reagent, Thermofisher, C10723) was added to each well and the slide returned to the incubator for another 60 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Dead and apoptotic cells were detected using the CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then counter-stained with fluoro-Nissl solution (Thermo Fisher Scientific Cat# N-21479). Sections were finally mounted on gelatine-coated glass slides ...
-
bioRxiv - Neuroscience 2019Quote: ... incubation for 3-5’ in 3,3’ diaminobenzidine (DAB, Acros Organics) staining solution (0.025% w/v DAB ...