Labshake search
Citations for Thermo Fisher :
6251 - 6300 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 22 µl of the eluent underwent reverse transcriptase (RT) treatment (Superscript IV, Thermo Fisher) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... RT-qPCR was performed using TaqMan Gene Expression assays (Hs01045030_m1 and 4333760F, Applied Biosystems) on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Genomics 2019Quote: RT-qPCR: We synthesized first-strand cDNA with M-MLV reverse transcriptase (Life Technologies), and performed qPCR with PowerUp SYBR Green Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... RT-qPCR was carried out in a StepOnePlus cycler and detection system (Applied Biosystems). Each reaction consisted of triplicate samples containing iTaq Universal Probes Supermix (BioRad) ...
-
bioRxiv - Genomics 2021Quote: ... The first strand synthesis was performed using 100 units of Superscript IV RT (Invitrogen) in 1x SS-IV RT buffer containing 10 units of RNase OUT (Invitrogen) ...
-
bioRxiv - Physiology 2021Quote: ... Peptide R.HQGVMVGMGQK.D++ RT = 8.9-13.4 min) was performed on a QExactive plus (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3 µg was reverse transcribed (RT) using the SuperScript III kit (Life Technologies). The resulting cDNA was used for qPCR ...
-
bioRxiv - Physiology 2021Quote: ... as controls and cDNA was generated using VILO RT Superscript (Thermo Fisher, 11755-250) from 8μL of RNA ...
-
bioRxiv - Cell Biology 2021Quote: ... were incubated at RT with 0.5 M glacial acetic acid (Fisher Scientific #BP1185-500) for 20–60 min and washed once with sterile milliQ (MQ ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were performed using TaqPath 1-step RT-qPCR master mix (Thermofisher, Waltham, MA) with 500 nM of each primer and 250 nM of each probe in a total reaction volume of 20 µl ...
-
bioRxiv - Immunology 2020Quote: ... reverse transcription (RT) was directly performed after thawing plates using SuperScript IV (Thermo Fisher) as previously described44,55 ...
-
bioRxiv - Immunology 2020Quote: ... Complementary DNA was generated from 1LJμg of total RNA with Superscript II RT (Invitrogen) and random hexamer primers (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-qPCR was performed in triplicate using the PowerUp SYBR Green Mix (ThermoFisher Scientific) and the primers listed in table S4 on a Quantastudio Real-time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... before 1 µg was reverse transcribed with Superscript III reverse transcriptase (RT; Thermo Fisher). Equal volumes of cDNA were used for qPCR ...
-
bioRxiv - Bioengineering 2022Quote: ... 60 µl/mL SuperScript III RT/Platinum Taq High Fidelity mix (Thermo Fisher Scientific), 1% BSA (Fisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... 30 µl/mL SuperScript III RT/Platinum Taq High Fidelity mix (Thermo Fisher Scientific), 0.5% BSA (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... for 30 min at RT and nuclei with DAPI (1:5,000; Thermo Fisher Scientific) for 15 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... barcoded cDNA of each sample was generated with a Maxima RT polymerase (Thermo Fisher) using oligo-dT primer containing barcodes ...
-
bioRxiv - Genetics 2022Quote: ... RT-qPCR was performed using TaqMan Gene Expression assays (Hs00266332_m1 and 4333760F, Applied Biosystems) on an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... and stained for 10 min at RT with 5 μM SYTO-9 dye (ThermoFisher) in MilliQ ...
-
bioRxiv - Plant Biology 2023Quote: RT-qPCR was performed using the PowerUP SYBR Green Master Mix kit (Applied Biosystems) according to the manufacturer’s manual ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was reverse transcribed into cDNA using the RevertAid RT Kit (Thermo Fisher Scientific). Gene expression was detected using the LightCycler 480 SYBR Green I Master Mix or Probes Master Mix kit (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2022Quote: ... Membranes were incubated for 1h at RT with fluorescent streptavidin (1:10000, Invitrogen, #S11378) diluted in 2% (w/v ...
-
Autocrine Sfrp1 inhibits lung fibroblast invasion during transition to injury induced myofibroblastsbioRxiv - Cell Biology 2022Quote: ... beads were harvested and the hybridized mRNA transcripts reverse transcribed (Maxima RT, Thermo Fisher). Unused primers were removed by the addition of exonuclease I (New England Biolabs) ...
-
bioRxiv - Plant Biology 2024Quote: ... RT‒qPCR was performed on a QuantStudio 6 Pro (Applied Biosystems, Waltham, MA, USA) using GoTaq® qPCR Master MixA6001 (Promega ...
-
bioRxiv - Biochemistry 2024Quote: ... All RT-qPCR reactions were performed in the platform abi 7500 (Thermo Fisher Scientific) using Mix PowerUp SYBR Green (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: The RT-qPCR was performed with an ABI PRISM 7500 Real-Time (Applied Biosystems) using the SYBR Green Master Mix with the primers listed in Supplementary Table S2 ...
-
bioRxiv - Genetics 2023Quote: RT-qPCR analysis was performed using the Platinum SYBR Green QPCR kit (Invitrogen #11744100) containing 10 μl cDNA with forward and reverse primers that hybridised to p75NTR exons 5 and 6 respectively (forward primer GAGAAACTGCACAGCGACAG and reverse primer CTCTACCTCCTCACGCTTGG) ...
-
bioRxiv - Microbiology 2024Quote: ... at 4°C to remove cells and debris (Thermo Fisher Sorvall Legend RT Centrifuge). In turn ...
-
bioRxiv - Immunology 2024Quote: ... The RT-qPCR was performed in a QuantStudio 3 (Applied Biosystems, Foster City, CA) using qScript XLT One-Step RT-qPCR ToughMix® ...
-
bioRxiv - Plant Biology 2023Quote: ... Reverse transcription (RT) was performed with SuperScript IV VILO Master Mix (ThermoFisher, cat#11756050). Following RT ...
-
bioRxiv - Immunology 2023Quote: First-strand cDNA was generated from 22uL total RNA using SuperScript RT IV (Invitrogen) and IgA ...
-
bioRxiv - Immunology 2023Quote: ... and 1.5 μL of SuperScript III RT (200 U/μL, Invitrogen, cat. no: 18080044) was added and it was incubated at 55 °C for 30 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... then for 1h at RT with prepared dynabeads sheep anti rabbit IgG (Invitrogen, #11203D). Coprecipiate was washed once with wash buffer (polysomal buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... and labeled for 1 hour at RT with 18 μg of TMT10plex (ThermoFisher Scientific) dissolved in 4 μl of acetonitrile (the label used for each experiment can be found in Supplementary Table 3) ...
-
bioRxiv - Microbiology 2023Quote: ... together with Alexa594-labelled phalloidin (Thermo Fisher Scientific, 2 units/mL, 45 min, RT). Nuclei were counterstained by Hoechst 33342 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and reverse transcribed to cDNA (SuperScript First Strand Synthesis Kit for RT-qPCR, Invitrogen) and qPCR was carried out (TaqMan Universal PCR Master Mix ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR was performed using a StepOnePlus qPCR system (Applied Biosystems, Waltham, MA, USA) with Power SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Physiology 2022Quote: ... RT-qPCR was performed on a QuantStudio™ 7 Flex System (Applied Biosystems, UK) in a total reaction volume of 20 µL comprised of 10 µL TaqMan universal PCR mastermix-II (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... RT and incubated with Alexa Fluor 568-conjugated peanut agglutinin (PNA; Life Technologies, L32458) diluted 1:500 in 1% BSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR analysis was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) and following primers:
-
MET functions in tumour progression and therapy resistance are repressed by intronic polyadenylationbioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed with the ABI Prism 7900 sequence detection system (Applied Biosystems) and PE biosystems analysis software according to the manufacturer’s manuals ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... cDNA synthesis was performed using SuperScript III RT first strand cDNA synthesis kit (Invitrogen). The amount of starting RNA in each reverse transcription reaction was 2 ug ...
-
bioRxiv - Immunology 2023Quote: ... Viral RNA was detected by RT-qPCR (TaqPath COVID-19 CE-IVD Kit, ThermoFisher) to confirm SARS-CoV-2 infection ...
-
bioRxiv - Biochemistry 2023Quote: ... spiralis muscle-stage larvae was reverse transcribed (RT) using Superscript IV reverse transcriptase (ThermoFisher) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... the samples were fixed at room temperature (RT) in 4% formaldehyde (Thermo Scientific, 28906) in PBS for 10 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... The amplification and fluorescence detection of quantitative RT-qPCR was performed in Q6 (Invitrogen), using the TAKARA TB Green Premix (RR420) ...
-
bioRxiv - Cell Biology 2023Quote: ... For cDNA synthesis we used the RevertAid RT Reverse Transcription Kit (Thermo Fisher, K1691). The qPCR reaction samples were made with the Promega GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 1 hour incubation at RT with BlockAid blocking solution (Life Technologies B10710). Primary antibodies (V5 ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-qPCR was performed using Fast SYBR Green Master Mix (Applied Biosystems, Cat#4385612) on the Applied Biosystems StepOne Plus qPCR machine with primers designed using Primer3Plus ...