Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for Recombinant Human GC Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... The recombinant protein was expressed in the Pichia pastoris strain SMD1168H (Philosof et al., 2017) (Thermo Fisher Scientific). The cells were harvested 48–60 h after expression was induced in BMMY medium when 10 mM of all-trans-retinal (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant protein was captured on a Ni2+-NTA HisPur® affinity resin by gravity flow (Thermo Fisher Scientific). Unbound proteins were washed with binding buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Expression and purification of recombinant proteins were performed according to manufacturer’s instructions (Invitrogen Corporation, Catalog no. K1710-01): YPD medium supplemented with 100 μg ml−1 zeocin was used for initial growth of P ...
-
bioRxiv - Biochemistry 2020Quote: The soluble recombinant protein was captured on a Ni2+-NTA affinity resin by gravity flow (Thermo Fisher Scientific). Unbound proteins were washed with 25 mM HEPES ...
-
bioRxiv - Immunology 2021Quote: ... Dinutuximab and dinutuximab LALA-PG were then purified using recombinant protein A-Sepharose 4B (ThermoFisher Scientific, Waltham, MA), buffer exchanged into antibody buffer (20mM L-Histidine ...
-
bioRxiv - Microbiology 2022Quote: The recombinant proteins named rS1Beta was purified using a CaptureSelect™ C-tagXL Affinity Matrix prepacked column (ThermoFisher) and followed the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2023Quote: Recombinant Endocan and PDGF-BB were labeled with Alexa Fluor 488 Microscale Protein Labeling Kit (Thermo Fisher Scientific) and Alexa Fluor™ 647 Microscale Protein Labeling Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Anthony White (QIMR Berghofer Medical Research Institute, Australia) were maintained on human recombinant vitronectin in StemFlex medium (Life Technologies, cat. # A3349401). Differentiation was performed as previously described [15 ...
-
bioRxiv - Systems Biology 2020Quote: ... 72 h after seeding on 96-well microplates differentiated cells were incubated with recombinant human interferon gamma (IFN-γ, ThermoFisher, #PHC4031) at concentrations 0-10 ng/mL or recombinant human interleukin 10 (IL-10 ...
-
bioRxiv - Cell Biology 2020Quote: ... coated overnight with 10 μg/ml of xeno-free human recombinant Laminin 521 (LN521, Biolamina) prepared in GMP DPBS+/+ (A1285801, Life Technologies) by reversing the strainer and washing the EBs into the plate with GMP N2 media (CTS™ DMEM-F12 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated in RP-10 supplemented with 10 ng/ml recombinant human IL-2 and 2 μg/ml anti CD28 (clone 37.51, Thermo Fisher Scientific) for 18-22 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 10% fetal bovine serum (FBS)) and 30IU/mL recombinant human IL-2 (rhIL-2; Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Cell Biology 2020Quote: ... HUVECs were treated with 30 ng/ml of VEGF (Recombinant Human Vascular Endothelial Cell Growth Factor, Fisher Scientific 10690920, Bordeaux, France) for 24 hours.
-
bioRxiv - Immunology 2021Quote: Purified CD8+ cells were cultured in AIMV medium supplemented with 10% FBS and 100 U/ml recombinant human IL-2 (ThermoFisher Scientific) and used for sorting of CD8+ T cell subsets and for further experiments three days after isolation.
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM β- Mercaptoethanol and 1 ng/ml human recombinant leukemia inhibitory factor) for 24 h and then treated with 0.1 μg/ml Colcemid (Gibco, 15210-040) for 2.5 h ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by a layer of 0.02 mg ml-1 human recombinant laminin (BioLamina) in DPBS containing Ca2+ & mg2+ (Thermo Fisher Scientific) was deposited on the electrode array ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by a layer of 0.02 mg ml-1 human recombinant laminin (BioLamina) in DPBS containing Ca2+ and mg2+ (Thermo Fisher Scientific) was deposited on the electrode array ...
-
bioRxiv - Cell Biology 2023Quote: ... were cultured in complete RPMI (10% FCS, 1% Penicillin/Streptavidin, 1% HEPES) supplemented with recombinant human M-CSF (10 ng/mL, Life Technologies) for 7-10 days to differentiate monocyte-derived macrophages (MDM) ...
-
bioRxiv - Developmental Biology 2023Quote: Stem cells were grown on culture plates coated with 5micro μg ml-1 recombinant human Vitronectin (rhVTN-N, Life Technologies, #A14700). HESCs were grown in mTeSR1 (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... except for RWPE1 which were maintained in Keratinocyte Serum Free Medium supplemented with bovine pituitary extract and human recombinant epidermal growth factor (manufacturer supplied, Life Technologies). For spheroid cultures ...
-
bioRxiv - Cancer Biology 2023Quote: H357 and H376 cells at ∼80 % confluence were treated either with distilled water (as control) or with 20 ng/ml of Human Recombinant FGF2 (PHG0026, ThermoFisher Scientific) for 48 h ...
-
bioRxiv - Cell Biology 2023Quote: Saturating amounts of recombinant human (rh) EGFR-Biotin and rhPD-L1-Biotin (ACRO Biosystems) were coated onto separate Streptavidin-coated DynaBeads (Thermo Fisher) using manufacturer’s protocol ...
-
Pathogenic CD8 T cell responses are driven by neutrophil-mediated hypoxia in cutaneous leishmaniasisbioRxiv - Immunology 2023Quote: ... 20 U/mL recombinant human IL-2 at 37°C and 5% CO2 for 24 hours in RPMI 1640 (Gibco, Canada) containing 100 Units of penicillin and 0.1 mg/mL of Streptomycin (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-well plates were coated with 20 µg/mL Human recombinant laminin-521 (Biolaminin; Biolamina; LN521-05) in 1x dPBS++ (Gibco; 14040117) and incubated overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 ng/ml human recombinant epidermal growth factor (EGF) and 50 µg/ml bovine pituitary extract (BPE)(all Thermo Fisher). Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant RNase H (Invitrogen) was later added to the reverse transcribed samples and incubated for 20 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant B18R (Life Technologies) was used at 1ug/ml ...
-
bioRxiv - Neuroscience 2019Quote: ... All proteins were expressed in Human Embryonic Kidney (HEK) 293 Freestyle cells (Invitrogen) in suspension culture using serum-free media ...
-
bioRxiv - Immunology 2023Quote: ... RBD proteins were expressed in-house in Expi293F human cells (Thermo Fisher Scientific) by transfection of the cells with purified DNA and polyethylenimine (PEI) ...
-
bioRxiv - Biochemistry 2023Quote: Proteins from human cell lines were extracted in IP lysis buffer (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... Stealth RNAi™ siRNA negative control med GC (Thermo Fisher Scientific) was used.
-
bioRxiv - Microbiology 2019Quote: ... 2.5 μL of GC enhancer (Thermo Fisher Scientific, Carlsbad, California, USA), 2 μL of DNA (1:10 diluted ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 µl of SuperFi GC enhancer (Thermo Fisher Scientific, Vilnius, Lithuania), 1 mmol/l each of reverse and forward verification primers (Supplementary Table S1) ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were analyzed using a GC Thermo Trace (Thermo Fisher Scientific) equipped with an autosampler (Model HS 2000) ...
-
bioRxiv - Microbiology 2023Quote: ... GC/MS data files were analyzed using Xcalibur software (Thermo Scientific). Sterol composition was calculated from peak areas ...
-
bioRxiv - Plant Biology 2023Quote: ... and injected into a gas chromatograph (Trace 1310 GC, Thermo Scientific) that was equipped with a HP-PLOTQ column (30 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stealth non-silencing Low-GC RNA duplexes (sictl, CGACAAUUGUGAGGUCUAAACUAUU, Life Technologies) were used as non-silencing control.
-
bioRxiv - Developmental Biology 2023Quote: ... The GC was coupled with a MS (ISQ 7000, Thermo Scientific). Injection temperature was 280°C ...
-
bioRxiv - Plant Biology 2023Quote: ... The sample was then run on a GC-MS (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... GC/MS data files were analyzed using Xcalibur software (Thermo Scientific). Sterol composition was calculated from peak areas ...
-
bioRxiv - Biochemistry 2023Quote: ... The purified FAMEs were then analyzed by GC-MS (Thermo Scientific gas chromatograph ...
-
bioRxiv - Cell Biology 2024Quote: ... Stealth RNAi siRNA Negative Control Med GC Duplex #2 (Thermofisher Scientific) was used.
-
bioRxiv - Biochemistry 2022Quote: ... The Z-scores for reactivity of SARS CoV-2 proteins to each human protein was determined by using ProtoArray Prospector v 5.2 software (Invitrogen, Thermo Fisher).
-
bioRxiv - Developmental Biology 2021Quote: ... containing 500 μm disk patterns were coated with 10 μg/ml recombinant human laminin 521 (BioLamina) diluted in pre-warmed DPBS (Thermo Fisher Scientific) for 3 hours at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... IPS cells were thawed and cultured at all times cultured on recombinant human laminin LN521 (Biolamina, 2021-21) kept in E8 basal medium (Thermo Fisher Scientific) supplemented with primocin (0.1 μg/ml ...
-
bioRxiv - Developmental Biology 2021Quote: ... ESCs were dissociated with TrypLE Express for 5 mins at 37°C and induced into EpiLCs by addition of human recombinant basic fibroblast growth factor (bFGF) (Invitrogen, 13256-029) and activin A (Peprotech ...
-
bioRxiv - Cell Biology 2021Quote: ... Phages displaying human Fabs were enriched after three rounds of biopanning on biotinylated recombinant human ACE2 immobilised to streptavidin Dynabeads (Dynal M-280, Invitrogen, cat # 112.06D). After the third round of panning ...
-
bioRxiv - Microbiology 2020Quote: ... To starve Chlamydia of tryptophan HeLa cells were incubated for 24 h in media containing 2 ng/ml recombinant human IFN-γ (Invitrogen: PHC4033) prior to infection ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were pulsed in starvation buffer supplemented with 0.1% w/v bovine serum albumin at 4 °C for 40 min with 50 ng/mL human recombinant EGF (Thermo-Fisher, Gibco™, PHG0311L) to allow ligand bind to the EGFR ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.055 mM β-mercaptoethanol (#21985-023) and recombinant human full-length bFGF (#PHG0261) at 10 ng/ml (all reagents from Life Technologies).