Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-aagaattggagggaccaccccc-3’ (underline is the codon change T to R) and 5-tgtcacgcgctcaaagtggttg-3’ using the fusion DNA polymerase (Thermofisher). After treating the PCR products with DpnI (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Developmental Biology 2024Quote: ... and passaged every 3–5 days after approximately 5 minutes of incubation with 0.5 mM EDTA (15575020, Life Technologies).
-
bioRxiv - Neuroscience 2021Quote: ... we added a 1 mL of the following mixture to the culture media and incubated the cells at 25°C incubator for 1—3 hours: 5 μM Fura-2 AM (F-1201, Life Technologies), 250 μM probenecid (162-26112 ...
-
bioRxiv - Neuroscience 2020Quote: ... tissues were washed in PBS (3×5 min) and incubated with secondary antibodies conjugated to Alexa Fluor 488 (1:400; goat anti–rabbit; Life Technologies) or Alexa Fluor 594 (1:400 ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 µl of 3 ng µl-1 cDNA was used as template in the QuantStudio 5 Real-Time PCR system (Applied Biosystems). Amplifications were performed with 5 μl of SYBR® green JumpStart Taq ReadyMix (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slices were then washed in PBS (3 × 10 min) followed by a 5 min incubation with DAPI (Thermofisher Scientific, 1: 5000) diluted in PBS ...
-
bioRxiv - Immunology 2020Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3.125 μM Oligo-dT 30 VN (IDT, 5′AAGCAGTGGTATCAACGCAGAGTACT 30 VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2022Quote: ... with cDNA (diluted 1:5) and gene-specific primers (Key Resources Table) on a QuantStudio 3 Real-Time PCR System (Applied Biosystems) in triplicate ...
-
bioRxiv - Evolutionary Biology 2021Quote: For ethanol preference assays, experimental substrates were 1% agarose and contained 75mM sucrose and increasing concentrations (3%, 5%, and 7%) of ethanol (ThermoFisher #BP2818); control substrates were 1% agarose and contained 75mM sucrose.
-
bioRxiv - Cell Biology 2021Quote: ... Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200, Life Technologies) diluted in 10% FBS for 1 hour at room temperature ...
-
bioRxiv - Genetics 2023Quote: ... Ovaries were washed 3 times for 5 min with PBTx before incubation at room temperature in 1 μg/mL DAPI (Invitrogen, ThermoFisher Scientific) solution in PBS for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 μM 6-JOE-conjugated reverse primer (5’-6-JOE-GATGATCTCCACCTTGCCGT-3’) was extended with 1 pmol of RNA as template using Superscript III (Thermo Fisher) as reverse transcriptase ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Bioengineering 2024Quote: ... and incubated for 3-5 minutes at 37°C with a 1:10 dilution of trypsin 2.5% (Thermo Fisher #15090-046) in PBS (HSCs ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse calvariae were dissected from 1–3 days old neonatal mice and digested sequentially 5 times for 25 minutes in α-MEM (Gibco) containing 0.1% collagenase (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... membrane was washed 3 x 5 min in PBS-T and incubated for 1 hour at RT with secondary antibody anti-mouse (Invitrogen #31439) or anti-rabbit (Invitrogen #31460 ...
-
bioRxiv - Genetics 2024Quote: ... cell pellets were incubated for 14 hours at 65 °C in 250 µl de-crosslinking buffer (1% SDS (Invitrogen), 1.25 µl DTT (Roth ...
-
bioRxiv - Biochemistry 2024Quote: ... dsRNA complex (2:1 molar ratio) were cross-linked with 30 μg 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Fisher Scientific, EDC: protein = 3:1 w/w) in the presence of 66 μg N-hydroxysulphosuccinimide (NHS ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3x with M9 and incubated for 1h in 0.2% DiI (Invitrogen) in M9 ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated for 1h with Streptavidin-Cy5 (SA1011, Thermo Fisher Scientific), diluted 1:500 in TNB ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-(4-amidinophenyl)-1H -indole-6-carboxamidine (DAPI; Thermo Fisher Scientific – D1306), 5X All-In-One RT MasterMix with AccuRT Genomic DNA Removal Kit (Applied Biological Material - G492) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1H was performed using an Applied Biosystems 7500 Fast (Thermo Fisher Scientific) with an Applied Biosystems PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2024Quote: ... monolayers were blocked for 1h using 1wt% BSA (37520, Thermo Fisher Scientific), 22.52 mg/mL glycine (410225 ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by 1h recovery in DMEM Methionine free media (Gibco, cat# 21013024) (recovery) ...
-
bioRxiv - Cell Biology 2020Quote: ... Scales were incubated for 2h at room temperature with AlexaFluor 488 Phalloidin (Thermo Fisher Scientific) diluted 1:250 in PBST ...
-
bioRxiv - Developmental Biology 2020Quote: ... and precipitated after a 2h long incubation with magnetic beads (Dynabeads Protein A, Invitrogen 10001D). Washes were carried out in RIPA-LS ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Immunology 2020Quote: ... the cells were stained for 1h with the LIVE/DEAD™ fixable near-infrared dead cell stain (1:1000 dilution, Invitrogen) along with the following labelled antibodies diluted in an ice-cold staining buffer (PBS supplemented with 1% BSA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following secondary antibodies were added for 1h at room temperature: anti-rabbit IgG-647 (1:500, Life technologies, A-21244), anti-rabbit IgG-488 (1:500 ...
-
bioRxiv - Pathology 2020Quote: ... (Extended Data Table 1) and corresponding fluorescently conjugated secondary antibodies (1h at RT) together with 10 μg/ml Hoechst 33342 (trihydrochloride, trihydrate, ThermoFisher Scientific). Sections were mounted with ProLong Gold Antifade mounting medium ...
-
bioRxiv - Cancer Biology 2021Quote: ... slides were washed and incubated for 1h at RT with 1:200 Alexa-fluor secondary antibodies: goat anti-rabbit 488 (Life Technologies), goat anti-rat 568 (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... After washing the coverslips with PBS, samples were incubated with appropriate secondary antibodies (1:1000, 1h at room temperature) from Thermo Scientific: goat α-rabbit combined with Alexa-405 (#A-31556) ...
-
bioRxiv - Genetics 2024Quote: ... samples were washed three times with PBS and incubated for 1h with the secondary antibodies Alexa Fluor 647-conjugated chicken anti-rabbit (1:200, #A21443, Life Technologies), Alexa Fluor 488-conjugated goat anti-mouse (IgG2a ...
-
bioRxiv - Neuroscience 2023Quote: ... membranes were washed and then incubated with the corresponding secondary antibodies for 1h at room temperature (Goat Anti-rabbit Secondary Antibody, HRP conjugate 1:1000, ThermoFisher #31460). All antibodies were diluted in a 5% BSA solution in TBS-T ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells incubated with secondary antibodies in blocking solution for 1h at RT in the dark (anti-chicken Alexa 568, 1:1000, A11041, Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... Freshly dissected SCG were digested 1h at 37°C in trypsin 1X (Trypsin 10X, Life technologies, diluted 1:10 in DPBS). Sympathetic neurons were dissociated ...
-
bioRxiv - Cancer Biology 2022Quote: ... Novusbio # NBP1-78278) was incubated for 1h at room temperature and revealed with a Pacific Orange-conjugated secondary antibody (1:50, ThermoFisher, # P31584). After DAPI counterstaining ...
-
bioRxiv - Molecular Biology 2024Quote: ... Secondary antibodies (1:20000) were incubated for 1h at room temperature and blots were imaged with ECL substrate (Thermo Scientific #32106) and Amershan Hyperfilm ECL (Cytiva # 28-9068-35).
-
bioRxiv - Cell Biology 2023Quote: ... Sections were washed with PBS and incubated for 2h at RT with the secondary antibodies: goat anti-mouse IgG Alexa Fluor 488 (Thermo Fisher, A31560, 1:500) and goat anti-rabbit IgG Alexa Fluor 647 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...