Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... cells were exposed for 1h at RT to secondary antibodies: Goat anti-chicken AlexaFluor 488 (1:1000, ThermoFisher, A21131), Donkey anti-rabbit AlexaFluor 555 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed three times within PBS and incubated for 1h at room temperature with the secondary antibody (Alexa-488 anti-mouse and anti-rabbit IgG, 1:2,000, Invitrogen; CY3 anti-rabbit ...
-
bioRxiv - Neuroscience 2024Quote: ... The secondary antibodies were diluted according to the manufacturer’s instructions and incubated for 1h at RT (488-ms/rb; 555-ms/rt; 647-ms, 1:1000, Invitrogen). Nuclei were visualized using 0,1μg/ml DAPI (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were washed 3 times with TBS-T and incubated 1h at RT with an HRP-conjugated anti-mouse secondary antibody (dilution 1:50,000, G-21040, Invitrogen). After 3 washes in TBS-T ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell were incubated at 37°C for 1h in thyroid organoid media with mitotracker green 1:1000 (Invitrogen, M7514) and mitosox red 1:500 (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μM triazole ligand Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amin (TBTA, Thermo Fisher Scientific, 454531000), 62.5 μM biotin-alkyne tag (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... the slides were incubated in a humidity chamber for 2h at RT with a secondary antibody cocktail composed of Streptavidin Alexa fluorophore 555 conjugate 1:400 (ThermoFisher Scientific, S21381) and goat anti-guinea pig Alexa fluorophore 647 1:200 (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... Coverslips were washed in PBS and incubated 2h at room temperature with secondary antibody (Donkey anti-rabbit-568, ThermoFisher Scientific, 1:400) and DAPI ...
-
bioRxiv - Neuroscience 2022Quote: ... Nissl (Neurotrace 640, 1:200 in 0.01 M PBS with 0.1% Triton X-100, 2h, Thermo Fisher Scientific #N21483, Waltham, MA, USA) or DAPI (1:10000 in 0.01 M PBS ...
-
bioRxiv - Immunology 2022Quote: ... The sections were washing with PBS and incubated with the appropriate secondary antibody solution for 2h at room temperature (IgG conjugated Alexa Fluor 594 and/or 647; 1:800; Invitrogen, Carlsbad, CA). The sections were washed with PBS and mounted with coverslips adding Aqueous Mounting Medium ...
-
bioRxiv - Neuroscience 2024Quote: ... washed three times for 10 minutes each at RT with TBST and probed for 2h at RT with a 1:500 dilution of an Alexa Fluor conjugated Goat anti-Rb antibody (Invitrogen cat. #: A11012) and a 1:1000 dilution of IB4-FITC (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... the tissue was blocked for 1h at RT in freshly prepared blocking solution and incubated for 2h at RT with 1:1000 goat-anti-rabbit-Alexa488 antibody (Invitrogen, A-11034), 1:5000 Hoechst33342 (Life Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... membranes were blocked for 1h with 2% I-Block (Thermo Fisher) prior to immuno-detection with mouse anti-GFP (UC Davis/NIH Neuromab Facility ...
-
bioRxiv - Neuroscience 2023Quote: ... for 1h and blocked with 10% normal goat serum (10000C, Invitrogen) and 0.25% Triton X-100 for 1 h ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... were incubated for 1h in LysoTracker Red DND-99 reagent (Invitrogen) 75nM concentration and for 30 min in 1X tubulin tracker deep red reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... and stained for 1h with an anti-GFP antibody (A10262, Invitrogen). Wells were washed three times with PBS and incubated with an anti-chicken Alexa Fluor 488 coupled secondary antibody (A11039 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Blocking – 1h at room temperature in 10% horse serum (Thermo Fisher), 1% w/v Bovine Serum Albumin (BSA ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were washed at least 5 times 20 min and transferred to 0.25% PBT with 1:400 TO-PRO-3 (ThermoFisher #T3605) for 2 nights ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were washed 3 x 5 min with PBS before adding secondary antibody (1:200 Alexafluor-488 goat anti-mouse, Invitrogen) and rhodamine phalloidin (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Then slides were washed 3×5’ in TBS and incubated in donkey-α-sheep-488 (1:500, Life Technologies, A11015) in TBS for 90’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were then washed with PBS-T (3 × 5 min) and incubated with fluorophore-conjugated secondary antibodies (1:500 in blocking buffer, Invitrogen). Hoechst 33258 (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation, Oregon, USA) followed by washing with 1x DPBS (nuclei data not shown) ...
-
bioRxiv - Neuroscience 2024Quote: ... The following day the sections were washed 3 times for 5 min each in PBS-T and incubated with the corresponding secondary antibodies (all 1:1000, Invitrogen), for 2 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1μl of oligo-dT30VN primer (10 μM 5’-aagcagtggttatcaacgcagagtact30vn-3’) and 1 μl of 10 mM dNTP mix (Thermo Fisher). Illumina libraries were prepared by using a modified smart-seq2 protocol [Picelli 2014] using SuperScript IV RT and tagmentation procedure as previously described [Henning 2018] ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was washed 3 times with 5% milk TBST and incubated with HRP-conjugated secondary antibodies (1:5000, 32230/32260; Invitrogen). Data were visualized using chemiluminescence detection on ChemiDoc Touch (Bio-Rad Laboratories).
-
bioRxiv - Bioengineering 2023Quote: ... KTB21 human mammary basal epithelial cell line was cultured in epithelial cell growth medium (DMEM [low glucose]: Ham’s F12 [1:3] medium supplemented with 5% FBS [Thermo Fisher Scientific] ...
-
bioRxiv - Developmental Biology 2023Quote: ... Stained samples were washed (3 x 5 minutes) and incubated in DAPI solution (Invitrogen, D3571; diluted 1:1000 in DPBS) for 10 minutes at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary cells were cultured in basal medium ((DMEM [low glucose]: Ham’s F12 [1:3] medium supplemented with 5% FBS [Thermo Fisher Scientific] ...
-
bioRxiv - Bioengineering 2024Quote: ... KTB21 human mammary basal epithelial cell line was cultured in epithelial cell growth medium (DMEM [low glucose]: Ham’s F12 [1:3] medium supplemented with 5% FBS [Thermo Fisher Scientific] ...
-
bioRxiv - Cell Biology 2024Quote: ... Mass spectrometric analysis of phosphorylated GST-yCTD was carried out in an AB Voyager-DE PRO MALDI-TOF (Brunker Corporation) with the 1:1 DHB matrix (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 3-methyl-1-butanol (Thermo Fisher Scientific) in mineral oil were used as cues ...
-
bioRxiv - Biophysics 2020Quote: ... were incubated for 2h together with phalloidin-FITC (Molecular Probes Inc, Eugene, OR, USA). Coverslips were mounted on microscopy slides and visualized with a HC PL APO 63x/1.40 Oil CS objective lens attached to a Leica TCS-SP5 II confocal microscope (Leica Microsystems ...
-
bioRxiv - Cell Biology 2024Quote: ... at 300 mAmp constant by 2h with 20% methanol 0.1% SDS transfer buffer (Invitrogen). The blotted membrane was stained using Ponceau S ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2024Quote: ... isolated cerebral microvessels (5 animals per group) or hippocampus (3-5 animals per group) using Trizol (ThermoFisher, MA) and the Qiagen RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... were obtained from the cell bank of Rio de Janeiro and cultured at 37 °C under 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, Gibco BRL, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-phosphohistone 3 (1:100, Invitrogen), anti-phosphoAMPK (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... TOTO-3 iodide (1/2000, Invitrogen) was added to the secondary antibody solution to label cell nuclei (Invitrogen) ...
-
bioRxiv - Genetics 2021Quote: ... 1/3 Neurobasal (Thermo Fisher Scientific), 1x N-2 Supplement (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... or ToPro-3 (1:1000, Invitrogen) added to the third wash to stain nuclei ...
-
bioRxiv - Immunology 2020Quote: ... 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB (Thermo Fisher Scientific; (Bruner et al., 2016)) ...
-
bioRxiv - Immunology 2020Quote: ... 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB (Thermo Fisher Scientific; (Schmid et al., 2010)).
-
bioRxiv - Microbiology 2021Quote: ... Sections were cut at 3-5 μm on a cryotome (ThermoFisher Scientific) using C35 carbon steel blades (Feather ...
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... 5 μl Turbo DNase buffer and 3 μl Turbo DNase (ThermoFisher Scientific) were added to each reaction and incubated for 30 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Cancer Biology 2022Quote: ... Cell pellet was suspended in 3-5 ml TrypLE Express (ThermoFisher, 12605028) depending on the pellet volume and incubated at 37°C for 10-15 min with mixing every 5 min ...