Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated with fluorescence conjugated secondary antibodies for 2h at RT [Alexa Fluor 488 donkey (1:1000, A21206, A21202, A11055, A21208, Invitrogen), Alexa Fluor 555 donkey (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were incubated with the following secondary antibodies and streptavidin reagent for 2h at room temperature: goat anti-mouse IgG Alexa Fluor 488 (1:1000, ThermoFisher), goat anti-rabbit CF568 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... The sections were then rinsed three times in PBS (0.01M) and incubated for 2h at RT with secondary antibodies: Alexa-546 donkey anti-rabbit (1:500, ThermoFisher, #A10040), Alexa-488 goat anti-chicken (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were then incubated for 2h at RT in the same blocking solution containing 1:1000 dilutions of corresponding Alexa secondary antibodies (Invitrogen) made in goat and coupled to either 488 ...
-
bioRxiv - Neuroscience 2023Quote: ... The slices were then incubated 2h at room temperature in goat anti-rabbit IgG 488 (1:200, Invitrogen - Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... The slides were then washed for 30 min in PBS followed by 2h incubation with Alexa-488-conjugated donkey anti-rabbit secondary antisera (1:500; Invitrogen). Slides went through a final wash for 30 min in PBS and mounted with glycerol containing (2.5% DABCO ...
-
bioRxiv - Neuroscience 2024Quote: ... they were incubated for 2h with the secondary antibody (Alexa Fluor 488-conjugated donkey anti-mouse antibody, 1:1000; Invitrogen). Finally ...
-
bioRxiv - Cell Biology 2024Quote: ... Sonicated chromatin was incubated overnight with 6 μg of C/EBPβ or IgG antibody (listed in Table 1) followed by 2h incubation with Dynabeads Protein G beads (Invitrogen). After five washes with LiCl buffer (100mM Tris pH 7.5 ...
-
bioRxiv - Physiology 2024Quote: ... and then incubated with fluorescence conjugated secondary antibodies (1:1000) for 2h at RT [primary neuronal cultures: Alexa Fluor 488 goat anti-rabbit (A11008, Invitrogen) and Alexa Fluor 568 goat anti-mouse (A-11004 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were washed 3x 5min in PBS and incubated for 2h at RT with the secondary antibodies [1/500 donkey anti-rabbit Alexa594 (A21207, Invitrogen) and 1/500 Streptavidin Alexa488 (S32354 ...
-
bioRxiv - Genetics 2024Quote: ... Tissue samples were then incubated for about 2h with 1 mL of an antibiotic solution containing Gentamicin (50 µg/mL Gibco) and PrimocinTM (50 µg/mL ...
-
bioRxiv - Developmental Biology 2024Quote: ... and incubated for 2h at room temperature with TRITC-coupled extravidin and Alexa Fluor 488 (1:200, Thermo Fisher Scientific). Cell membranes were stained with wheat germ agglutinin (WGA Rhodamine ...
-
bioRxiv - Cell Biology 2023Quote: ... and incubated for 1h at RT with Alexa fluor dye-conjugated secondary antibodies (1:500) and Alexa-555-coupled phalloidin (1:400, Invitrogen, A34055) diluted in PBS buffer supplemented with 0.5% BSA ...
-
bioRxiv - Genomics 2023Quote: ... and their media was replaced on day 1 with DE induction Media A (Gibco Cat# A3062601), and on day 2 with DE induction Media B (Gibco Cat# A3062601) ...
-
bioRxiv - Immunology 2024Quote: ... 50 nM de-phosphorylated/biotinylated NEK7 (produced in house) and 1 nM Terbium-Streptavidin (Invitrogen, PV3576) in buffer containing 50 mM TRIS-HCL ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were washed 3 x 5 min and incubated for 10 min with DAPI (1/2000, Invitrogen #D1306) diluted in PBT + 0.5% BSA ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Microbiology 2022Quote: ... Vero-E6 cells and Calu-3 were treated with 5 μg/ml or 1 μg/ml puromycin (Gibco), respectively ...
-
bioRxiv - Developmental Biology 2023Quote: ... we slowly injected 0.5-1 μL rAAV (about 1∼3×109 genome copy (GC)) mixed with Chicago Sky Blue dye (0.1%, Fisher Scientific, Cat # AAA1424214) into the oviduct ampulla using a glass micropipette with tip diameter of ∼10-30 μm ...
-
bioRxiv - Molecular Biology 2023Quote: ... and lungs were dissected and placed in ice cold FACS buffer (1% BSA, 3% FBS, 96% Ca2+ and Mg2+ free PBS) with 1 μg/ml Actinomycin D (ThermoFisher BP606-5). After isolation ...
-
bioRxiv - Cell Biology 2023Quote: ... were seeded on the top of the membrane and cultured for 3 days in DMEM/F12 (1/1) supplemented with 5 % fetal bovine serum (Fetal Clone II; Hyclone, Thermo Scientific, France), 0.2 ng/ml EGF (Gibco) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... HEK293FT and HEK293FT-LP cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco 25300-054). All HEK293FT cell lines generated by engineering either the HEK293FT or HEK293FT-LP parent cell lines were cultured in the same way ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the human hepatocyte cell line HepG2 (Banco de Células do Rio de Janeiro, #0103) were cultured in DMEM high glucose (Thermo Fisher Scientific) supplemented with 4 mM L-glutamine ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were cooled for 5 minutes under cold running tap water and washed for 5 minutes each in de-ionized water and PBS on a shaker before circumscribing with a Super PAP pen (Thermo Fisher Scientific) and blocking ...
-
bioRxiv - Cancer Biology 2021Quote: The TMA was placed in a hybrid TOF.SIMS 5 (IONTOF GmbH, Münster, DE) instrument coupled to a Q Exactive HF (Thermo Scientific, San Jose, CA) mass spectrometer without any dessication ...
-
bioRxiv - Microbiology 2021Quote: ... and vacuum-filtered onto a 0.2 μm sterile nitro-cellulose filter (Nalgene™, Thermo Scientific, USA). The filter containing enriched bacteria was folded ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Cancer Biology 2024Quote: ... protein was transferred to a nitro-cellulose membrane using the iBlot semi-dry system from Invitrogen, blocked in 5% milk in TBST ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated for 1h with a HisProbe-HRP conjugated antibody (ThermoFisher), washed with TBS-T and the blot was developed using Super Signal West Pico Substrate (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... run at 180V for 1h in 1X MOPS (ThermoFisher, NP0001). For smaller proteins ...
-
bioRxiv - Microbiology 2020Quote: ... for 1h at 37°C and 0.05% trypsin (Invitrogen, 25300054) for 15min at 37°C and re-plated at a density of 400 cells/μl of Matrigel (Corning ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 1h at room temperature followed by phalloidin Alexa546 (ThermoFisher) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... for 1h and concentrated 4X using SpeedVac concentrator (Thermo Scientific). DNA was then transformed into NEB 10β High-efficiency Electrocompetent E.Coli ...
-
bioRxiv - Developmental Biology 2020Quote: ... ToPro-3 (1:1000, Invitrogen). Secondary antibodies used in this study were purchased from Invitrogen and include ...
-
bioRxiv - Cell Biology 2020Quote: ... Eggs were washed extensively in D-PBSTB and incubated with secondary antibodies for 2h at RT - donkey anti-rabbit Alexa 555 (dilution 1:1000; Molecular Probes), goat anti-rat Alexa 488 (dilution 1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then washed in PBS and incubated for 2h with secondary antibodies conjugated to either AlexaFluor 488 or 594 (1:400, Life Technologies) and then washed again ...
-
bioRxiv - Cell Biology 2023Quote: ... were serum-starved in FBS-free DMEM for 2h and then were incubated with 1µg.µL-1 of transferrin-conjugated to Alexa-Fluor-647 (Tf-647, Life Technologies, T-23366) for 10 min at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were then rinsed in PBS and incubated for 2h at room temperature with secondary antibodies: Alexa488 donkey anti-guinea pig (1:500, ThermoFisher, A11073), Alexa488 goat anti-chicken (1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... After 3×10 min washes in PBS slices were incubated for 2h at RT in PBS containing a secondary antibody (donkey anti-goat Alexa Fluor Plus 647, 1:500, A21447, Invitrogen, UK). During a final round of washes tissue slices were counterstained with DAPI (NucBlue™ Fixed Cell ReadyProbes™ Reagent ...
-
bioRxiv - Evolutionary Biology 2022Quote: The purified RNA was used to amplify cDNA from the gUTRGFP template with the 5’ Cy-5 labelled pWP252fluor primer (5’ ATAACGGACTAGCCTTA 3’) using the standard Superscript III First-Strand Synthesis System (Thermo Fisher) with 3 µg of total RNA and elongating at 52.5°C for 60 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... aegypti embryos at specified developmental stages (0-1h, 4-5h, 5-6h, 23-24h, 47-48h, and 71-72h) using Trizol® reagent (Ambion by Life Technologies), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Ultracentrifuge at 1,20,000g for 2h at 4°C (Optima max instrument, Thermo Scientific).
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Microbiology 2020Quote: ... and probe E_Sarbeco_P1 (5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ-3′) using the TaqPath 1-Step Multiplex Master Mix kit (Applied Biosystems) on a QuantStudio 5 real-time PCR system (Appiled Biosystems) ...