Labshake search
Citations for Thermo Fisher :
5901 - 5950 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Viral genome copies were quantified by real-time quantitative PCR (qPCR) using SYBR green dye (Thermo Fisher Scientific) and primers specific for the HCMV UL36 ORF (ACGCAAAGAGTTCCTCGTAC and TGAACATAACCACGTCCTCG) ...
-
bioRxiv - Immunology 2024Quote: ... Relative gene expression was determined by quantitative real-time PCR on a QuantStudio 3 System (Thermo Fisher Scientific) with TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific 4444557 ...
-
bioRxiv - Immunology 2024Quote: ... was used to carry out the reactions in an QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) under standard conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and qPCR was performed using the QuantStudio 6 Flex Real-Time PCR System with SYBR green (ThermoFisher Scientific). Expression was normalized to TBP ...
-
bioRxiv - Immunology 2023Quote: ... and transcript expression was quantified by real-time PCR using a StepOne plus thermocycler (Applied Biosystems, Carlsbad, CA). Expression levels were normalized with respect to β-actin ...
-
bioRxiv - Immunology 2023Quote: ... The qPCR was performed using the QuantStudio 5 Real-Time PCR System (Applied Biosystems by Thermo Fisher Scientific). The increase in mRNA expression was determined by the 2-ΔΔCt method relative to the expression of the house-keeping gene Ubc or ΔCt relative to Actin.
-
bioRxiv - Immunology 2023Quote: ... The qPCR was performed using the QuantStudio 5 Real-Time PCR System (Applied Biosystems by Thermo Fisher Scientific). The increase in mRNA expression was determined by the 2-ΔΔCt method relative to the expression of the house-keeping gene Ubc or ΔCt relative to Actin.
-
bioRxiv - Microbiology 2023Quote: ... and then primers listed in Supplemental Table 2 on a ViiA 7 real-time PCR system (Applied Biosystems) with the following cycling parameters ...
-
bioRxiv - Physiology 2023Quote: ... two-step real-time PCR was performed according to manufacturer instruction using TaqMan MicroRNA Assays (Life Technologies, USA), and 10 ng of total RNA was used for the reverse transcription (RT ...
-
bioRxiv - Physiology 2023Quote: ... and Applied Biosystems Fast Real-time PCR system 7900HT according to the manufacturer’s protocol (Thermo Fisher Scientific, USA). In each qRT-PCR reaction (performed in duplicates) ...
-
bioRxiv - Microbiology 2023Quote: ... The concentrations of RNA libraries were measured by StepOnePlus Real-Time PCR System (ThermoFisher Scientific, San Jose, CA) with the KAPA Library Quantification Kit (Kapabiosystems ...
-
bioRxiv - Microbiology 2023Quote: ... thetaiotaomicron using a Applied Biosystems QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems, Foster City, CA, USA), primer sets BT2156-BT2160 ...
-
bioRxiv - Developmental Biology 2023Quote: Transcript levels were determined by quantitative real-time PCR (qPCR) using TaqMan® gene expression assays (Applied Biosystems) on a 7300 fast RT-PCR System (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... at a total volume of 10 µl in an ABI 7500 Fast Real Time PCR cycler (Applied Biosystems). For absolute quantification ...
-
bioRxiv - Physiology 2023Quote: ... Quantitative real-time PCR was performed using TaqMan Gene Expression Master Mix (#4369016, Applied Biosystems, Thermo Fisher Scientific) and Quanta studio 3 (Applied Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... using the ABI PRISM 7500 Fast real-time PCR system and custom data analysis software (Thermo Fisher Scientific). Each reaction contained the equivalent of 5 ng cDNA as a template ...
-
bioRxiv - Physiology 2023Quote: ... Quantitative real-time PCR was performed using TaqMan Gene Expression Master Mix (#4369016, Applied Biosystems, Thermo Fisher Scientific) and Quanta studio 3 (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: Reaction was performed in a QuantStudio 12K Flex Real-Time PCR system with Array Card block (Life Technologies). In most cases ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA quantification was performed using the ABI StepOnePlus Real Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA), followed by high-throughput sequencing on the Illumina HiSeq2500 ...
-
A systematic approach identifies p53-DREAM target genes associated with blood or brain abnormalitiesbioRxiv - Genetics 2023Quote: ... and real-time quantitative PCRs were performed on an ABI PRISM 7500 using Power SYBR Green (Applied Biosystems) as previously described [26] ...
-
bioRxiv - Molecular Biology 2023Quote: ... with primers for RNAs of interest (Supplementary Table S1) on a QuantStudio Real-Time PCR system (Thermo Fisher). Relative levels were quantified using the ΔΔCt method73.
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time PCR was carried out on an Applied BioSystems 7500 Fast thermocycler (Applied Biosystems. Inc., CA; USA) programmed as follows ...
-
bioRxiv - Genetics 2023Quote: ... a real-time PCR was run utilizing TaqMan™ Assays to measure expression of UBE3A (Hs00166580_m1) (ThermoFisher, #4331182) versus GAPDH (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was performed using SYBR green master mix on a QuantStudio 3 real-time PCR instrument (Applied Biosystems). Fold enrichment (n-fold ...
-
bioRxiv - Plant Biology 2023Quote: ... using the ABI PRISM 7500 Fast real-time PCR system and custom data analysis software (Thermo Fisher Scientific). Each reaction contained the equivalent of 5 ng cDNA as a template ...
-
bioRxiv - Cancer Biology 2023Quote: ... Immunoprecipitated DNA was analyzed by qPCR on a QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems) with Power SYBR Green PCR Master Mix and calculated as % of input ...
-
bioRxiv - Cell Biology 2023Quote: ... Slide Book Software 6.0 (Intelligent Imaging Innovations) and QuantStudio 6 Real-Time PCR Software (Applied Biosystem, Thermo Fisher). *P<0.05 ...
-
bioRxiv - Immunology 2023Quote: ... was used for qPCR and was performed on StepOnePlus™ Real-Time PCR System (ThermoFisher Scientific, SFR BioSciences). Primer sequences were designed to target Gag and LTR from lentiviruses and TBP and U6 from the host (as controls) ...
-
bioRxiv - Cell Biology 2023Quote: ... and specific primers on a 7,500 fast real-time PCR system (Applied Biosystems, Life Technologies, Waltham, MA, USA). The relative levels of gene transcripts were normalized to GAPDH which were determined by quantitative real-time PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... and specific primers on a 7,500 fast real-time PCR system (Applied Biosystems, Life Technologies, Waltham, MA, USA). The relative levels of gene transcripts were normalized to GAPDH which were determined by quantitative real-time PCR ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence data for SYPRO Orange signal was collected with a ViiA 7 Real-Time PCR System (Applied Biosystems) and QuantStudio Real-Time PCR Software v1.2 using 470 ± 15 nm excitation and 586 ± 10 nm emission filter ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Amplifications were performed using an ABI Prism 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). RT-qPCR data were normalized to TATA-box-binding protein (Tbp ...
-
bioRxiv - Immunology 2023Quote: ... qPCR analysis: Real-Time PCR on cDNA was performed using PowerUp SYBR green Master mix (ThermoFisher Scientific #A25742) and analyzed with an Quantstudio3 (Applied Biosystems) ...
-
Lysyl oxidase regulates epithelial differentiation and barrier integrity in eosinophilic esophagitisbioRxiv - Cell Biology 2023Quote: ... and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Hs02786624_g1) using the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific Inc.). Relative mRNA levels of each gene were normalized to GAPDH levels as a housekeeping control.
-
bioRxiv - Evolutionary Biology 2023Quote: ... qPCR analysis was performed on a StepOne Plus™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA) using the PowerUp SYBR® Green Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were analyzed in duplicate with a Real-Time PCR System (StepOnePlus, Applied Biosystems, Foster City, CA, USA). The following reaction primers sequences were used ...
-
bioRxiv - Plant Biology 2023Quote: ... The relative copy number and expression experiments were performed using StepOne™ Real-Time PCR System (Applied Biosystems) with genomic DNA (∼10 ng ...
-
bioRxiv - Bioengineering 2023Quote: ... and the fluorescence signals were traced by the quantitative real-time PCR QuantStudio 5 (Thermo Fisher Scientific, USA) with λex = 495nm and λem = 520nm ...
-
bioRxiv - Microbiology 2023Quote: ... The reactions were then run on a QuantStudio 5 Real-Time PCR Instrument (A28133, Applied Biosystems, Waltham, MA).
-
bioRxiv - Microbiology 2023Quote: ... using a QuantStudio 7 Flex Real-Time PCR System utilizing Fast SYBR™ Green Master Mix (Applied Biosystems).
-
bioRxiv - Neuroscience 2023Quote: ... Relative gene expression of the cDNA was assayed using a 7500 Fast real-time PCR instrument (Applied Biosystems) with SYBR Select Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... The concentrations of RNA libraries were measured by StepOnePlus Real-Time PCR System (ThermoFisher Scientific, San Jose, CA) with the KAPA Library Quantification Kit (Kapabiosystems ...
-
bioRxiv - Immunology 2023Quote: ... All samples were performed in duplicates and measured on either ViiATM 7 Real-Time PCR System (ThermoFisher Scientific) or ABI Prism 7300 Sequence Detector (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... cruzi (GenBank AY520036) was quantified by real time PCR using specific Custom Taqman Gene Expression Assay (Applied Biosystems). Primers and probes sequences were previously described by Piron et al ...
-
bioRxiv - Cell Biology 2023Quote: ... 10μl reactions were run for forty cycles on the Viia7 Real-Time PCR System and Software (Life Technologies). Samples were normalized to GAPDH and analysis performed via the QuantaStudio™ Real-Time PCR Software ...
-
bioRxiv - Cell Biology 2023Quote: ... and reactions were run and analyzed on a Quant Studio 12K Flex Real-Time PCR system (ThermoFisher Scientific) following the standard Fast SYBER Green protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... and specific primers on a 7,500 fast real-time PCR system (Applied Biosystems, Life Technologies, Waltham, MA, USA). Amplification was carried out at 95 °C for 12 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and specific primers on a 7,500 fast real-time PCR system (Applied Biosystems, Life Technologies, Waltham, MA, USA). Amplification was carried out at 95 °C for 12 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Individual qPCRs were carried out on the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA) using iTaq Universal SYBR green supermix (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR reactions were run in a QuantStudio 6 Flex Real-Time PCR system (Thermo Fisher, Cat. No. 4485691) and Ct values were obtained using built-in software ...