Labshake search
Citations for Thermo Fisher :
5851 - 5900 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... 3 Pzrewalski and 40 SBs) using the StepOnePlus Real- Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) and the custom TaqMan SNP genotyping assay (82) ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR assays were carried out in duplicate or triplicate using the QuantStudio3 Real-Time PCR system (Applied Biosystems). qPCR was performed using Taqman probes (Supp Table 9 ...
-
bioRxiv - Neuroscience 2022Quote: The levels of pth2 transcripts were determined by quantitative real-time PCR (qPCR) using SYBR green dye (Invitrogen) and a CFX Connect real-time thermal cycler (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... monocytogenes actA gene was performed on a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA). Reactions were conducted in triplicate using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time q-PCR was performed following the manufacturer’s protocol using an ABI 7500HT thermal cycler (Applied Biosystems). A cycle threshold cut-off of 0.2 was applied to all gene amplifications and was normalized to Ribosomal protein L4 (RPL4 ...
-
bioRxiv - Cell Biology 2022Quote: ... were used for qPCR in a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA) according to the manufacturer’s protocol for 40 cycles ...
-
bioRxiv - Physiology 2022Quote: ... Transcript levels of genes of interest were quantified using StepOne Real time PCR system (Thermo Scientific, CA, USA); qPCR primer sequences are shown in Supplementary Table 1 ...
-
bioRxiv - Physiology 2022Quote: ... and qPCR reactions were set up and performed on the StepOne-Plus Real-Time PCR System (Applied Biosystems) as previously described (Wilson ...
-
bioRxiv - Cell Biology 2022Quote: ... The expression of target genes was determined using QuantStudio™ 1 Real-Time PCR system (Thermo Fisher Scientific). PCR amplification was performed using PowerTrack™ SYBR™ Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... The qPCRs were performed on a QuantStudio3 real-time PCR system (Applied Biosystems, Thermo Fisher Scientific, Waltham, USA).
-
bioRxiv - Microbiology 2022Quote: ... Gene expression was assayed by real-time quantitative PCR using Maxima SYBR Green qPCR Master Mix (Thermo Scientific) on a Biorad C1000 real-time PCR system ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we ran two technical replicate reactions in an QuantStudioTM 7 Flex Real-Time PCR System (Applied Biosystems™). We used 4μL of genomic template ...
-
bioRxiv - Microbiology 2024Quote: ... The qPCR runs were performed using Applied Biosystems™ StepOne™ Real-Time PCR System (Thermo Fisher Scientific) and THUNDERBIRD® SYBR qPCR Mix (Toyobo) ...
-
bioRxiv - Systems Biology 2023Quote: All qPCR data were acquired on a Quant Studio™ 6 Real-Time PCR System (Thermo Fisher Scientific). The thermocycling conditions (SYBR Green reactions ...
-
bioRxiv - Plant Biology 2024Quote: ... Data was analysed with QuantStudio 6 and 7 Pro Real-Time PCR Systems Software (Thermo Fisher Scientific, America). For RT-qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... The resulting amplified cDNA library was quantified using the QuantStudio™ 5 Real-Time PCR System (Thermo Fisher) via qPCR ...
-
Autism genes converge on microtubule biology and RNA-binding proteins during excitatory neurogenesisbioRxiv - Systems Biology 2024Quote: ... Quantitative real-time PCR was performed using Applied Biosystems PowerUp SYBR Green Master Mix (Fisher Scientific, Cat#A25742) on QuantStudio6 real-time PCR system ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time polymerase chain reaction (PCR) analysis was performed using 2x SYBR Green Master Mix (Thermo Fisher Scientific) on an ABI Prism 7900 Sequence Detection System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... All reactions were conducted in duplicates using a 7500 Fast Real-Time PCR System (Applied Biosystems, ThermoFisher, USA) with the following conditions ...
-
bioRxiv - Microbiology 2024Quote: ... All reactions were conducted in duplicates using a 7500 Fast Real-Time PCR System (Applied Biosystems, ThermoFisher, USA) with the following conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... with 10 ng cDNA input in triplicates on a QuantStudio 5 real-time PCR system (Thermo Fisher Scientific). Primer sequences are listed in Supplemental Table S1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... quantitative real-time polymerase chain reaction (qRT-PCR) was later performed using TaqMan® (Thermo Fisher, Paisley, UK) gene expression assays ...
-
bioRxiv - Immunology 2024Quote: ... Quantitative Real-Time PCR was performed in triplicate with SYBR green on a StepOne Plus (both Applied Biosystems) using previously described primers for Ifng and Rpl32 mRNA (39) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The subsequent qPCR analysis was performed with the StepOnePlus™ Real-Time PCR System and Software (Applied Biosystems) using an initial denaturation at 95°C for 2 min followed by 40 cycles of PCR stage at 60°C for 30 sec ...
-
bioRxiv - Biophysics 2023Quote: ... and the fluorescence signals were traced by the quantitative real-time PCR QuantStudio 5 (Thermo Fisher Scientific, USA) with λex = 495 nm and λem = 520 nm ...
-
bioRxiv - Immunology 2023Quote: ... following the standard cycling conditions suggested by the manufacturer in a StepOnePlus real time PCR system (Applied Biosystems). VSVeGFP and 18S mRNA were used as control housekeeping genes ...
-
bioRxiv - Microbiology 2024Quote: ... Viral genome copies were quantified by real-time quantitative PCR (qPCR) using SYBR green dye (Thermo Fisher Scientific) and primers specific for the HCMV UL36 ORF (ACGCAAAGAGTTCCTCGTAC and TGAACATAACCACGTCCTCG) ...
-
bioRxiv - Immunology 2024Quote: ... Relative gene expression was determined by quantitative real-time PCR on a QuantStudio 3 System (Thermo Fisher Scientific) with TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific 4444557 ...
-
bioRxiv - Immunology 2024Quote: ... was used to carry out the reactions in an QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific) under standard conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and qPCR was performed using the QuantStudio 6 Flex Real-Time PCR System with SYBR green (ThermoFisher Scientific). Expression was normalized to TBP ...
-
bioRxiv - Immunology 2023Quote: ... and transcript expression was quantified by real-time PCR using a StepOne plus thermocycler (Applied Biosystems, Carlsbad, CA). Expression levels were normalized with respect to β-actin ...
-
bioRxiv - Immunology 2023Quote: ... The qPCR was performed using the QuantStudio 5 Real-Time PCR System (Applied Biosystems by Thermo Fisher Scientific). The increase in mRNA expression was determined by the 2-ΔΔCt method relative to the expression of the house-keeping gene Ubc or ΔCt relative to Actin.
-
bioRxiv - Immunology 2023Quote: ... The qPCR was performed using the QuantStudio 5 Real-Time PCR System (Applied Biosystems by Thermo Fisher Scientific). The increase in mRNA expression was determined by the 2-ΔΔCt method relative to the expression of the house-keeping gene Ubc or ΔCt relative to Actin.
-
bioRxiv - Microbiology 2023Quote: ... and then primers listed in Supplemental Table 2 on a ViiA 7 real-time PCR system (Applied Biosystems) with the following cycling parameters ...
-
bioRxiv - Physiology 2023Quote: ... two-step real-time PCR was performed according to manufacturer instruction using TaqMan MicroRNA Assays (Life Technologies, USA), and 10 ng of total RNA was used for the reverse transcription (RT ...
-
bioRxiv - Physiology 2023Quote: ... and Applied Biosystems Fast Real-time PCR system 7900HT according to the manufacturer’s protocol (Thermo Fisher Scientific, USA). In each qRT-PCR reaction (performed in duplicates) ...
-
bioRxiv - Microbiology 2023Quote: ... The concentrations of RNA libraries were measured by StepOnePlus Real-Time PCR System (ThermoFisher Scientific, San Jose, CA) with the KAPA Library Quantification Kit (Kapabiosystems ...
-
bioRxiv - Microbiology 2023Quote: ... thetaiotaomicron using a Applied Biosystems QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems, Foster City, CA, USA), primer sets BT2156-BT2160 ...
-
bioRxiv - Developmental Biology 2023Quote: Transcript levels were determined by quantitative real-time PCR (qPCR) using TaqMan® gene expression assays (Applied Biosystems) on a 7300 fast RT-PCR System (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... at a total volume of 10 µl in an ABI 7500 Fast Real Time PCR cycler (Applied Biosystems). For absolute quantification ...
-
bioRxiv - Physiology 2023Quote: ... Quantitative real-time PCR was performed using TaqMan Gene Expression Master Mix (#4369016, Applied Biosystems, Thermo Fisher Scientific) and Quanta studio 3 (Applied Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... using the ABI PRISM 7500 Fast real-time PCR system and custom data analysis software (Thermo Fisher Scientific). Each reaction contained the equivalent of 5 ng cDNA as a template ...
-
bioRxiv - Physiology 2023Quote: ... Quantitative real-time PCR was performed using TaqMan Gene Expression Master Mix (#4369016, Applied Biosystems, Thermo Fisher Scientific) and Quanta studio 3 (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: Reaction was performed in a QuantStudio 12K Flex Real-Time PCR system with Array Card block (Life Technologies). In most cases ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA quantification was performed using the ABI StepOnePlus Real Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA), followed by high-throughput sequencing on the Illumina HiSeq2500 ...
-
A systematic approach identifies p53-DREAM target genes associated with blood or brain abnormalitiesbioRxiv - Genetics 2023Quote: ... and real-time quantitative PCRs were performed on an ABI PRISM 7500 using Power SYBR Green (Applied Biosystems) as previously described [26] ...
-
bioRxiv - Molecular Biology 2023Quote: ... with primers for RNAs of interest (Supplementary Table S1) on a QuantStudio Real-Time PCR system (Thermo Fisher). Relative levels were quantified using the ΔΔCt method73.
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time PCR was carried out on an Applied BioSystems 7500 Fast thermocycler (Applied Biosystems. Inc., CA; USA) programmed as follows ...
-
bioRxiv - Genetics 2023Quote: ... a real-time PCR was run utilizing TaqMan™ Assays to measure expression of UBE3A (Hs00166580_m1) (ThermoFisher, #4331182) versus GAPDH (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... qPCR was performed using SYBR green master mix on a QuantStudio 3 real-time PCR instrument (Applied Biosystems). Fold enrichment (n-fold ...