Labshake search
Citations for Thermo Fisher :
5751 - 5800 of 10000+ citations for 7 Chloromethyl 2 2 dimethyl 2 3 dihydro 1 benzofuran since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... RNA samples were treated with 1 µl DNase I (2 U) (Ambion™, #AM2222) per 10 μg of total RNA in a 50 μl reaction for 30 minutes at 37°C ...
-
bioRxiv - Immunology 2020Quote: 1×106 LDN or NDN were suspended in PBS-/- + 2% fetal calf serum (Gibco) and stained with CD66b ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were probed with monoclonal HA Tag antibody (1:2000 dilution, Invitrogen, 2-2.2.14,), incubated with anti-mouse IgG-horseradish peroxidase (IgG-HRP ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated 1-2 h in secondary antibodies Alexa-488 and Alexa-647 (ThermoFisher) to label GFP and Fas3 ...
-
bioRxiv - Microbiology 2023Quote: ... 1-2 ug of RNA was converted to cDNA using reverse transcriptase (Applied Biosystems).
-
bioRxiv - Immunology 2023Quote: ... Luc-Screen™ Extended-Glow Luciferase buffers 1 and 2 (ThermoFisher, Cat No. T1035) used according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1-2 drops of ProLong Gold Antifade Mountant (cat# P36930, Molecular Probes, Eugene, OR) were added ...
-
bioRxiv - Microbiology 2023Quote: ... DNA were stained with 1 µg/ml 4′′,6-diamidino-2-phenylindole (DAPI, Invitrogen) for 15 min at RT ...
-
bioRxiv - Microbiology 2023Quote: ... cells were stained with 1:1000 DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen) for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... After blocking for 1 hour in 2% bovine serum albumin (BSA; BP9701, Fisher Scientific) in PBS ...
-
bioRxiv - Immunology 2023Quote: The Caco-2/THP-1 co-cultures were washed thrice with DPBS (Gibco, #10010023) to remove any residual substances ...
-
bioRxiv - Developmental Biology 2023Quote: ... The LSC growth medium contains 2:1 Dulbecco’s Modified Eagle Medium (Life Technologies, 21969035) and F12 (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... filtered through a slow filter paper (#293; 1–2 µm Sartorius, Thermo Fisher Scientific), and then used to determine electrical conductivity (EC) ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Immunology 2023Quote: ... Lymphocytes were plated at 1-2 × 106 cells/mL in RPMI: RPMI 1640 (Gibco) supplemented with 15% FCS ...
-
bioRxiv - Microbiology 2022Quote: ... mouse anti-claudin 1 monoclonal antibody (2 µg/ml, 37-4900, Thermo Fisher Scientific); rabbit anti-claudin 3 polyclonal antibody (1:100 dilution ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; 1:1,000; D1306, Invitrogen). Sections were mounted with ProLong™ Gold Antifade Mountant (P36934 ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI,1:20000, Invitrogen D3571) diluted in PBS to visualize cell nuclei (data not shown) ...
-
bioRxiv - Biophysics 2024Quote: ... HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)) was obtained from Fisher Scientific (Pittsburg, PA). Peptides were reconstituted at 25 mg ml-1 in nuclease-free ultra pure water as per the manufacturer’s instructions and stored as aliquots at -20°.HP1α was reconstituted (0.5 mg ml-1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... After counterstaining with 4′,6-diamidino-2-phenylindole (DAPI, 1:5,000, #62248, Thermo Scientific), slides were mounted using ProLong Gold Antifade Mountant with DAPI (#P39941 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2) Concentrate worms by centrifugation (1 minute, 4000-RPM, Thermo Scientific Sorvall Legend X1R), discard the supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse anti-E-cadherin (2 μg/ml, clone HECD-1; Invitrogen, Carlsbad, California, USA) and mouse anti-CX3CL1 (2 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 mL of enhancer 1 and 0.15 mL of enhancer 2 (Expifectamine kit, Gibco) were added to the cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... and AF647 rat anti-Intercellular adhesion molecule 2 (ICAM2, 1:250, A15452, Thermo Fisher).
-
bioRxiv - Cell Biology 2023Quote: ... 2% of Horse Serum and 1% of penicillin-streptomycin (Thermo Fisher, Waltham MA, USA).
-
bioRxiv - Biochemistry 2023Quote: ... and 1% SDS buffer and digested with 2 µL RNAse Cocktail (Thermo Fisher, AM2286) for 4 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... PANC-1 and MIA PaCa-2 cell lines were cultured in DMEM medium (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 h and Alexa Fluor 594-conjugated streptavidin (1:500, Thermo Scientific, S32356) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... stained using FITC-conjugated F(ab’)2-Goat anti-human IgA (Invitrogen; 1/1000) in PBS + 0.1% BSA for 20 minutes ...
-
bioRxiv - Immunology 2022Quote: ... 1-2×104 cells were lysed in 200 µL of TRIzol (Thermo Fisher Scientific) and RNA was isolated according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg mL-1 10,000 MW FITC lysine charged dextran (ThermoFisher Scientific, Waltham, MA) and 50 ng µL-1 of Renilla Luciferase (RLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... 1-2 µg of total plasmid DNA was transfected using lipofectamine 3000 (Thermo Scientific). Cells were trypsinized and replated onto No 1.5 coverglass the following day and analyzed ∼12-16 h later by indirect immunofluorescence ...
-
bioRxiv - Microbiology 2022Quote: ... and 15 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco, Gaithersburg, MD, USA). Cells were maintained at 37 °C in a humidified incubator with 5% CO2.
-
bioRxiv - Neuroscience 2022Quote: ... then a fluorescent Nissl stain was applied (1:200 in 2% NDST, Thermo Fisher N21479 for MORmCh and KORtdTomato or N21483 for DORGFP and NOPYFP ...
-
bioRxiv - Immunology 2022Quote: ... then with 2 μl of 20 mg ml−1 proteinase K (Thermo Fisher Scientific) for 1 h at 55° C ...
-
bioRxiv - Immunology 2022Quote: ... Transfections were performed using with a 2:1 ratio of lipofectamine 2000 reagent (Invitrogen) to DNA.
-
bioRxiv - Biophysics 2023Quote: ... 1 mM TCEP (tris(2-carboxyethyl)phosphine (TCEP) and EDTA-free protease inhibitors (ThermoFisher). Cells were lysed by sonication and the cell debris pelleted at 50000 x g and 4 °C for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µL 1 M DTT and 27.5 µL of T4 Polynucleotide Kinase (Thermo Scientific) were added to the annealed oligonucleotides and the reaction was incubated for 2 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The microwells were in lysis buffer (1% 2-mercaptoethanol (Fisher Scientific, cat# BP176-100), 99% Buffer TCL (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... viruses were mixed 1:2 with PBS-washed sheep blood (Fisher Scientific, MA, USA) supplemented with 5 mM ATP ...
-
bioRxiv - Physiology 2023Quote: Isolated cardiomyocytes were loaded with 1 μM Fura-2 AM (Invitrogen, Carlsbad, California, USA) at room temperature for 15 min and then washed for 15 additional min with an external Ringer solution containing (in mmol/L) ...
-
bioRxiv - Microbiology 2024Quote: ... for 1 h at 4°C.The DynaMag™-2 magnetic rack (Thermo Fisher Scientific) was used for flow-through removal and washing ...
-
bioRxiv - Cell Biology 2024Quote: ... freshly diluted 1:500 in imaging media (Leibovitz’s L-15 [Gibco] with 2% FBS). 1 mL of differentiated HL-60 cells were spun down at 200x g for 3 min and resuspended in 500 µL of the labeling solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... Alexa Fluor 647 rat anti-intercellular adhesion molecule 2 (ICAM2, 1:500, A15452, ThermoFisher), rat anti-MKI67 (KI67 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and ERCC RNA ExFold RNA Spike-In Mix 1 and 2 (Thermo Fisher Scientific) were added to wild-type and Meioc-null samples ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then incubated in 1 mL crosslinking solution containing 2% formaldehyde (Pierce, ThermoFisher Scientific) (50mM HEPES Buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... nuclei were stained with 1:1000 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) for visualisation of tissue structure ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% BSA and 1:1000 AF488 donkey anti-rabbit secondary (Thermo Fisher, A-21206) and incubated at room temperature and protected from light for 30 min ...
-
bioRxiv - Pathology 2024Quote: ... The retinas were blocked for 2 hours at room temperature in 1% FBS (Gibco), 3% BSA (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Caki-1 and Caki-2 cells were cultured in McCoy’s 5A modified medium (Gibco) supplemented with 10% FBS and 1% P/S ...