Labshake search
Citations for Thermo Fisher :
5701 - 5750 of 10000+ citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... PCR amplicons were resolved by 1–2% agarose gel electrophoresis and visualized by staining with SYBR Safe (Thermo Scientific). Negative control samples were always analyzed in parallel with experimental samples to identify mis-priming products ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cell pellets were finally resuspended in wash buffer containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) or 7-AAD viability dye (BioLegend ...
-
bioRxiv - Cell Biology 2023Quote: ... for 5 min and hybridized with smFISH probes diluted 1:3000 in hybridization buffer (10% dextran sulfate, Sigma D8906, 20% formamide, 1 mg/ml E. coli tRNA, Sigma R1753, 2× SSC, 0.02% BSA, Ambion AM2616 ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 1:5000 dilution of Alexa Fluor 488 labeled goat anti-rabbit IgG 2° Ab (Invitrogen, A-11070) with blocking buffer and incubated for 30 min at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... all applicable cell lines were selected using Puromycin (L929 – 10μg/mL, C3H – 1 ug/mL, NIH3T3 2 μg/mL, ThermoFisher) and Hygromycin B (L929 ...
-
bioRxiv - Cancer Biology 2023Quote: ... THP-1 cells were cultured in R10 supplemented with 0.05 mM 2-mercaptoethanol (21985023; Thermo Fisher Scientific, Waltham, MA). MV-4-11 cells were cultured in IMDM supplemented with 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... PANC-1 and MiaPaCa-2 were cultured and maintained in growth medium [DMEMF/12 with GlutaMAX™ Supplement (Gibco), + 10% v/v Heat Inactivated Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were subsequently incubated for 2 hours in secondary antibodies (all 1:500; Thermo Fisher Scientific, Waltham, MA, USA) diluted in 5% FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... inoculation of 2×106 THP-1 cells expressing firefly luciferase and GFP in 100 μL of PBS (Gibco, USA). Mice were randomly assigned to 4 experimental groups and 1 control group ...
-
bioRxiv - Microbiology 2023Quote: ... the sections were incubated with SARS-CoV-2 antibody against the nucleocapsid (N) protein (ThermoFisher MA536086; 1:28,000 dilution) for 15min at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... and incubated with DMEM supplemented with 1% Pen/Strep and 2% (v/v) horse serum (Gibco, differentiation medium, DM) at the same condition for differentiation ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were seeded on glass petri-bound hydrogels prepared with 1 µl/ml of 0.1% FluoSpheres Carboxylate-modified microspheres (0.2 µm, 580/605, 2%) (Thermo Fisher) aqueous solution ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by cell viability staining with LIVE/DEAD™ Fixable Blue/Violet (2 µl/ 1×106cells) (Invitrogen, ThermoFisher Scientific) for 20 minutes at room temperature in darkness ...
-
bioRxiv - Cancer Biology 2024Quote: ... washed with dH2O (1 time x 2 minutes) and mounted using Fluoromount-G (Thermo Fisher Scientific, #00-4958-02).
-
bioRxiv - Biophysics 2024Quote: ... at a 6:1:2 ratio for each virus using the Bac-to-Bac baculovirus expression system (Thermo Fisher). Cell cultures were grown in ESF 921 medium (Expression Systems ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by cell viability staining with LIVE/DEAD™ Fixable Blue/Violet (2 µl/ 1×106cells) (Invitrogen, ThermoFisher Scientific) for 20 minutes at room temperature in darkness ...
-
bioRxiv - Developmental Biology 2024Quote: ... incubated at room temperature for 2 hours in the secondary antibodies (Alexa 488 Donkey anti-Chicken, 1/200, Invitrogen; and CY3 Donkey anti-rabbit ...
-
bioRxiv - Cell Biology 2024Quote: ... worms were immobilized on 2% agar pads on microscope slides in ∼1 μl of 100 mM levamisole (ThermoFisher #AC187870100) and then coverslip applied.
-
bioRxiv - Microbiology 2024Quote: ... Supernatants issued from TSST-1 challenge were assessed for IL-2 concentration by enzyme-linked immunosorbent assay (ELISA) according to manufacturer’s protocol (Invitrogen). The plates were read at 450nm and 570nm in Biotek Synergy H4 multimode plate reader.
-
bioRxiv - Neuroscience 2024Quote: ... Slides were then incubated for 2 hours in goat anti-rabbit 647 secondary antibody (1:400, Invitrogen A-21245). All immunohistochemistry steps were performed at room temperature.
-
bioRxiv - Microbiology 2024Quote: Sterilized seeds were placed on petri dishes containing 1/2 MS (Caisson, Smithfield, UT, USA; CatNo. MSP01-50LT) with 1.5% phytagel (Invitrogen, Waltham ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of each Primer (40 pmoles) and 1 μl of PfuTurbo DNA Polymerase (2.5 U/μl) (Invitrogen, USA). The total volume was adjusted to 50 μl using nuclease-free water (Ambion ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1-2 days with Alexa Fluor 647 mouse (A21235) and 488 rabbit (A11008) secondary antibodies (Thermo Fisher Scientific). After imaging with a Zeiss 900 upright confocal with 20x 1.0 NA water-dipping objective ...
-
bioRxiv - Neuroscience 2024Quote: ... Appropriate volumes of lysate (1-2 μg of protein per μl) in 1x SDS sample buffer (Thermo Fisher Scientific) were heat-denatured 95 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... a stock solution (1 mM in DMSO) of membrane-permeant acetoxymethyl ester Fura-2 AM (Life Technologies, Eugene OR) was prepared and diluted to 8 µM in 1 ml of fresh growth medium (see Primary hippocampal cultures) ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were minced to a size of 0.5-1 mm3 and digested in Advanced DMEM+++ supplemented with 2% fetal bovine serum (Gibco), 2 mg/ml collagenase-P (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2024Quote: ... Slides were then stained with DAPI (1:10,000; 4’, 6-diamidino-2-phenylindole; Cat. No. D3571; Thermo Fisher Scientific) for 10 minutes at room temperature and mounted with glass coverslips using 1:1 PBS and glycerol as mounting medium ...
-
bioRxiv - Neuroscience 2024Quote: ... using the digital stereotactic apparatus 1 μl of 2 mg/ml biotinylated dextran amine (BDA; MW 10,000; Molecular Probes) in PBS was injected at 6 specific coordinates (3 sites/side ...
-
bioRxiv - Microbiology 2024Quote: ... a single wasp was homogenized in 40 μl of buffer (10 mM Tris-Cl pH 8.2, 1 mM EDTA, 25mM NaCl) containing 2 mg/ml proteinase K (Invitrogen). The lysates were incubated for 15 min at 65 °C ...
-
bioRxiv - Neuroscience 2024Quote: Harvested plasma samples were lysed with 2% SDS in 1× TBS (25 mM Tris, 0.15 M NaCl, pH 7.2; Thermo Scientific) supplemented with a 1 × protease inhibitor cocktail ...
-
bioRxiv - Physiology 2024Quote: ... Slides were then stained with DAPI (1:10,000; 4’ ,6-diamidino-2-phenylindole; cat. no. D3571; Thermo Fisher Scientific) for 10 minutes at room temperature and mounted with glass coverslips using 1:1 PBS and glycerol as mounting medium ...
-
bioRxiv - Immunology 2024Quote: ... Antigens were separately diluted down to a concentration of 60nM in 50µl of the 2:1 ratio of RPMI media (Gibco) + FLIPR Calcium 6 dye (Molecular Devices ...
-
bioRxiv - Immunology 2024Quote: ... The supernatant was then decanted and the cells were resuspended at a 2:1 ratio of RPMI media (Gibco) + FLIPR Calcium 6 dye (Molecular Devices) ...
-
bioRxiv - Bioengineering 2024Quote: ... T cells were cultured at a 1:2 cell:bead ratio with cultured αCD3/αCD28 activator beads (Thermo Fisher Scientific) and 50 ng/mL recombinant IL-2 (BioLegend ...
-
bioRxiv - Neuroscience 2024Quote: ... the membrane was incubated in 10 mL of 3% BSA/TBST (w/v) with 2 µL streptavidin-HRP (1:5,000; S911, Invitrogen) for 1 hour at room temperature ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... samples were incubated in Tyramide development solution (2% Dextran sulfate, 0.0015% hydrogen peroxide, 0.2mg/ml Iodophenol, 1:100 Alexa Fluor 488 Tyramide (ThermoFisher # B40953) in PTw ...
-
bioRxiv - Bioengineering 2024Quote: ... PEGαMA hydrogels were made by dissolving the PEGαMA in pH 8.4 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Life Technologies) at 12.5-15.5 weight percent (wt%) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were resuspended in 1 mL cold lysis buffer per plate (20 mM HEPES-NaOH pH 7.9, 150 mM NaCl, 2 mM EDTA, 0.1% Triton X-100, 1 mM PMSF added fresh, 1X Thermo Scientific HaltTM Protease Inhibitor Cocktail added fresh) ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transfected with the Cas9 plasmids and Cas13 plasmids (1:2 ratio) using Lipofectamine 2000 (Invitrogen; #11668-027) for 24 hours before RNA extraction ...
-
bioRxiv - Molecular Biology 2024Quote: ... shZBP1-2 GCACAATCCAATCAACATGAT within the pLKO.1 vector (MiliporeSigma, TRCN0000123050) were transfected into HVECs using Lipofectamine 3000 (Invitrogen, L3000001). After transfection ...
-
bioRxiv - Immunology 2024Quote: ... envelope (1.25 μg) and delta envelope plasmids (2.50 μg) were mixed in a 1:2 ratio in Opti-MEM (Gibco), with a final volume of 200μl per well ...
-
bioRxiv - Developmental Biology 2024Quote: ... Seeded cultures were incubated for 2 hours before adding 500µl media (DMEM [Thermo Fisher, 11995065]; 1% Pen Strep [Gibco 15-140-163] ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured in 10 or 15 cm Petri dishes at a density of ∼1 x 105 cm-2 for 7 d in differentiation medium comprising Iscove’s modified Dulbecco’s medium (IMDM, Gibco 12440053), 10% v/v FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... and run for 1-2 hours at 100V in parallel with GeneRuler1 kb Plus DNA Ladder (Thermo Fisher, UK). Gels were imaged using a Syngene Gel Doc system.
-
bioRxiv - Cell Biology 2024Quote: ... a 1 cm segment of intestinal tissue was minced and digested in 2 mg/ml Collagenase I solution (Invitrogen) with Gentamicin (Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... About 1 μg tryptic peptides in 10 μL solution was loaded onto a 2 cm trap column (Thermo Scientific) and then separated on a 50 cm EASY-Spray analytical column (Thermo Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... The constructed plasmids pGEM-H3.1-HaloTag and pX330-H3.1-gRNA were electroporated into the 10T1/2 cells using the Neon Transfection System (Invitrogen). The 10T1/2 clone stably expressing mouse H3.1-HaloTag was selected as described above ...
-
bioRxiv - Bioengineering 2024Quote: ... and eluted in 20 μL H2O, before predigestion (1 μg extended barcode, 2 μL Esp3I (Thermo Fisher Scientific, FD0454), 2 μL 10X FastDigest buffer (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μl of 5x First Strand buffer (Y02321) + 1 μl RNaseOUT Recombinant Ribonuclease Inhibitor (40 units/ μl) (100000840) + 2 μl 0.1 M DTT (Y00147) from Invitrogen were added and incubated for 1 minute at 42°C ...
-
bioRxiv - Neuroscience 2021Quote: ... or rabbit IgG antibody (2 μg, Thermo Fisher), as well as anti-S ...