Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies, 1:250) to reveal actin and the nucleus ...
-
bioRxiv - Physiology 2020Quote: ... and subsequently 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:50000) for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:50000 dilution, Molecular Probes) was treated in the cells for 3min ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, #D1306, 1/1000) were incubated overnight at 4°C in the dark ...
-
bioRxiv - Genomics 2023Quote: ... 1X 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES) (Thermo Fisher Scientific), 1X MEM non- essential amino acids (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (Gibco) and 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2020Quote: ... and 5 ng/ml IL-4 (Life Technologies), and evaluated on day 6 of culture ...
-
bioRxiv - Microbiology 2022Quote: ... 4 µL linear acrylamide (5 mg/mL, ThermoFisher), and 1 mL of ice-cold 96% ethanol followed by overnight incubation at −20°C.
-
bioRxiv - Systems Biology 2023Quote: ... 4 μL 5× phusion HF buffer (Thermo Scientific), 4 μL 5 M Betaine (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-cleaved-caspase-4/5 (Invitrogen, # PA5-39873),anti-cleaved caspase-3 (CST ...
-
bioRxiv - Cell Biology 2024Quote: ... with 5 µM di-4-ANEPPDHQ (Invitrogen, #D36802) in DMSO ...
-
bioRxiv - Genetics 2020Quote: ... Cells were passaged 1:2-1:6 every 2-4 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 µl/cm2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-phospho-Pak1-2-3 (pSer141) (44-940G, 1:2000) from Invitrogen/Thermo Fisher Scientific (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... phospho-PAK1/2/3 (Thr402) (ThermoFisher PA1-4636, 1:1000 for WB), phospho-PAK4 (Ser474)/PAK5 (Ser602)/PAK6 (Ser560 ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... were aspirated using a 21-gauge needle attached to a 5 mL disposable syringe in the presence of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-buffered TCM-199 medium (Gibco, Life Technologies, Milan, Italy) and 0.005% (w:v ...
-
bioRxiv - Neuroscience 2024Quote: ... The electrodes were labeled with DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethyl indocarbocyanine, Invitrogen, USA) to enable reconstruction of the electrode tracks postmortem (Figure 1B) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed 3 times in PBST and mounted in 4′,6-diamidino-2-phenylindole (DAPI)-containing ProLong Anti-fade Diamond mountant (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... The samples were washed again in PBS for 3×15 min and mounted in DAPI (4-,6-diamidino-2-phenylindole; Life Technologies, D1306) for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... were separated using NuPAGE Bis-Tris gels (4 – 12 %) with 3-(N-morpholino)propanesulfonic acid (MOPS) or 2-(N-morpholino)ethanesulfonic acid (MES) running buffer (Thermo Fisher Scientific) followed by transferring to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2022Quote: N2A cells were transfected as described above with BicD2-KIF tail fusions and MBNL-GFP proteins at a ratio of 2:3 in 4-well chamber slides (Thermo Fisher, 154526). 24 hours after transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... Adult brains were post-fixed for up to 24 hours with 4% paraformaldehyde and cryosectioned after 2-3 days of incubation in 30% sucrose (Thermo Fisher Scientific) in PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... dsRNA complex (2:1 molar ratio) were cross-linked with 30 μg 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Fisher Scientific, EDC: protein = 3:1 w/w) in the presence of 66 μg N-hydroxysulphosuccinimide (NHS ...
-
bioRxiv - Developmental Biology 2022Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes (min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Human naive PSCs were passaged as single cells every 4 days at split ratio 1:3 or 1:4 following dissociation with TrypLE (Gibco 12563-029) for 10 minutes at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and passaged every 4-5 days with 1 mg/ml dispase (Gibco).
-
bioRxiv - Neuroscience 2024Quote: ... and passaged every 4-5 days with 1 mg/ml Dispase (Gibco). The human FUSWT line ...
-
bioRxiv - Microbiology 2024Quote: ... at physiological pH before being spun down and resuspended in PBS with the addition of FM 1-43 Dye (N-(3-Triethylammoniumpropyl)-4-(4-(Dibutylamino) Styryl) Pyridinium Dibromide (Cat. no. T3163, Invitrogen). Images were taken on a Zeiss X10 light microscope and cell area was measured using CellProfiler 4.2.1 (33,34).
-
bioRxiv - Molecular Biology 2023Quote: ... stained with N-(3-triethylammonium propyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM 1-43FX, Invitrogen, Cat.-No. F35355) at 5.6 µg ml-1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Cell Biology 2021Quote: ... Rev: 5’-TCATTGAGACACCATTTGTC-3’ were cloned into pCR™4-TOPO® TA vector using the TOPO-TA cloning kit (Thermo Fisher 450030) and sequence verified.
-
bioRxiv - Cell Biology 2024Quote: ... or luciferase siRNA (5’ CGUACGCGGAAUACUUCGA 3’, control) were transfected in above RPE1 cells using 4 µl of lipofectamine siRNAmax (Thermo Fisher Scientific, 13778075) and 10 µM of siRNA in 2 ml of cell culture media ...
-
bioRxiv - Cell Biology 2024Quote: ... experiments were grown overnight in SDC at RT and then diluted in SDC and grown at 30°C for >4 h before being treated with either 500 µM 3-indole acetic acid (3-IAA; AID) for 1h or 1 µM estradiol + 1 µM 5-phenyl-IAA (5-Ph-IAA; Fisher Scientific) for 2h (grAID ...
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4 µM TO-PRO-3 Iodide (TOPRO, Thermo Scientific). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA) ...
-
bioRxiv - Microbiology 2024Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined via dynamic light scattering (DLS ...
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...