Labshake search
Citations for Thermo Fisher :
651 - 700 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... and removed by treatment with 3-5 mL trypsin (Gibco) then pelleted by centrifugation at 300 × g for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- UUUCCUUCCACUCGGAUAAGAUGCUGA-3’ were transfected with RNAiMaX (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 x 5 min with PBS (Gibco #14200-067) and fixed with 4 % (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 5 mg/ml linear acrylamide (Ambion), 600 μl of preheated (65°C ...
-
bioRxiv - Cell Biology 2022Quote: ... and Ca2+-indicator Fluo-4/AM (5 μM, Invitrogen) in the presence of Pluronic F-127 (0.02% ...
-
bioRxiv - Biochemistry 2021Quote: ... Hi-5 cells (BTI-TN-5B1-4) (Gibco #B85502) were cultured in Express Five™ SFM (Serum-Free Media ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... adding 2 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific) and 1 μM QUMA-1 23 to the final wash ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae at 5 dpf were incubated in 3 µM FM 1-43 (Thermofisher, T3163) in E3 media for 35 s ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Physiology 2024Quote: ... only 4 wells of cells were incubated in DMEM with 4 μM fura-2/AM (fura-2/AM, Molecular Probes, USA) at 37° C in the dark for 45 min ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 2 μM cell-permeant Fluo-4 acetoxymethyl ester (Fluo-4-AM, Thermo Fisher) with the addition of the equal quantity (1:1 v/v ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA oligonucleotides were obtained as pre-designed siRNAs as follows: MFF-sense strand: 5’-CGCUGACCUGGAACAAGGAdTdT-3’ for exon 2 30 (Ambion, Austin, TX, USA); DLP1-sense strand ...
-
bioRxiv - Neuroscience 2022Quote: ... free floating NAc sections were first washed (3 × 5 min) in 1x PBS containing 2% Triton X-100 (PBST) (Thermo Fisher, Waltham, MA). Sections were then blocked in 5% normal goat serum (NGS ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were passaged every 3-4 days using Accutase (Life Technologies) and reseeded at 0.5×104 cells/mL on Geltrex-coated (Life Technologies ...
-
bioRxiv - Genomics 2021Quote: ... followed by 3 mL of methanol (Fisher Scientific; Cat #A454-4), and 600 µL of 3% HCl (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... and the [4– 3] destination vector (pCFJ201) using LR clonase (Invitrogen). Plasmids were inserted into the worm genome as a single copy using the MosSCI technique (Frøkjaer-Jensen et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.05% Trypsin-EDTA (Gibco), and after a few passages ...
-
bioRxiv - Cell Biology 2022Quote: ... and passaged every 3-4 days with 0.25% Trypsin-EDTA (Gibco).
-
bioRxiv - Cell Biology 2024Quote: ... Fast DiI (1,1′-dilinoleyl-3,3,3′,3′-tetramethylindocarbocyanine, 4-chlorobenzenesulphonate, D7756, Invitrogen) to back label parasympathetic preganglionic neurons (PPNs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were passaged every 3-4 days with TrypLE (12604013, Gibco). Cells were authenticated by STR and tested for mycoplasma annually through Genetica Inc a subdivision of LabCorp.
-
bioRxiv - Biophysics 2023Quote: ... with 3% (v/v) acetonitrile (Thermo Fisher, Cat. No. A996SK-4) and B was 100% acetonitrile ...
-
bioRxiv - Immunology 2022Quote: The production of NO was evaluated using 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA)(D23844; Invitrogen, Waltham, MA). Following leukocyte isolation ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then washed 4-5 times in PBS for 2 hours and mounted onto glass slides using ProLong Gold Antifade Mountant (Invitrogen; Cat #P36930). Sections were imaged on a Leica SP8 upright confocal laser scanning microscope using a X10/NA 0.45 objective ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% Fetal Bovine Serum (FBS), 4°C) and incubated (37°C, 2 minutes) in protease solution (TrypLE express, Thermo Fisher 12604013) supplemented with DNase (100 U/ml ...
-
bioRxiv - Physiology 2024Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of cells were collected by centrifugation at 1500 rpm for 5 min at 4°C and stained with anti-SARS-CoV-2 RBD antibody (Invitrogen, PA5-114529). After centrifugation ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 to 4 µL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 µm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Cell Biology 2024Quote: Cells (2 – 5 x 106) were washed two times with cold PBS and lysed with RIPA buffer at 4°C (Thermo Fisher Scientific) supplemented with protease inhibitor (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear staining was performed using 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng ml−1; Molecular Probes). Sections were cover-slipped using ProLong Glass mounting agent (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were incubated in secondary antibody (Table 2) with 4’,6-diamidino-2-phenylindolefor (DAPI, 1:1000, Invitrogen) 45 minutes at room temperature in a rocking platform ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were dehydrated by sequential submersion in 100% ethanol (2× 5 min) and SafeClear II (2× 5 min, Fisher Scientific) before being mounted in Cytoseal 60 (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 52h after plating 5 µM 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was added for 20 h ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Biochemistry 2024Quote: ... 50 μg/mL streptomycin and 2 ng/mL mouse IL-3 (mIL-3, Gibco, Thermo Fisher). 32D cells were maintained in identical culture media with the exception of being supplemented with 15% WEHI-3B cell-conditioned media as a source of IL-3.
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated overnight at 4°C in blocking solution (PBS, 2% normal goat serum, 3% BSA) and primary antibodies (mouse anti-HA, Invitrogen; rabbit anti-GFP, Invitrogen). Cells were then immunolabeled with Alexa-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... differentiated Th2 cells were restimulated with anti-mouse CD3 (4 µg/mL) for 3 hours followed by 2 hours of incubation with monensin (Thermo Fisher Scientific, MA, USA) at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: Parasites after treatment were washed in 5 mL complete medium at 400 g for 3 min and stained with 5 μM JC-1 (ThermoFisher Scientific) in complete medium in the dark at 37 °C for 30 min ...
-
bioRxiv - Microbiology 2024Quote: ... and test virus RNA was detected with forward (5′-CTATGCTGTATACGGATTCGTCC-3′) reverse (5′-GGTGTCACCACAACAATCCAC) primers using a Power SYBR green RNA-to-Ct 1-step kit (Applied Biosystems) on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl 5 M NaCl and 1 µl GlycoBlue co-precipitant (Invitrogen). Samples were vortexed and incubated at room temperature for 15 min ...
-
bioRxiv - Immunology 2020Quote: ... The 2× RT mastermix contained 1 μl 5× SuperScript II buffer (Thermofisher), 0.25 μl 100 mM DTT (Thermofisher) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Cancer Biology 2021Quote: ... EdU 10μM (5-ethynyl-2’-deoxyuridine, ThermoFisher Scientific) diluted in fresh medium was added in the well for 10 minutes (MIA PaCa-2) ...