Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Plant Biology 2024Quote: ... The NTF sequences were amplified using primers (5’-CACCATGGATCATTCAGCGAAAACCACACAG-3’ and 5’-TCAAGATCCACCAGTATCCTCATGC-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). The CAB2 promoter region (324 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... or siMIIP (s34150, sequence sense 5’- AGGAGUUUCGGGAAACCAAtt-3’), or siPOC5 (AD39Q91, sequence sense 5’- CAACAAAUUCUAGUCAUACUU-3’) using Lipofectamine RNAi MAX reagents (Invitrogen). Medium was changed 5-6 hours post-transfection ...
-
bioRxiv - Biophysics 2021Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Cell Biology 2020Quote: ... A pool of 4 siRNAs targeting mouse SNAP-47 and control Luciferase siRNA (Target Sequence: 5’-CGTACGCGGAATACTTCGA-3’) (Dharmacon, Thermofisher Scientific) were electroporated along with GFP into E15.5 cortical neurons (2 µg GFP + 50 pmol siRNAs) ...
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Cell Biology 2023Quote: ... maintained at 37° C and 5% CO2 and passaged every 3-4 days using trypsin-EDTA 0.05% (Life Technologies, Paisley, UK) to detach the cells ...
-
bioRxiv - Physiology 2024Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Immunology 2022Quote: ... 700 μg of protein were mixed and rotated with 0.5 μg of STING antibody for 3 h at 4 °C after which 25 μL of Dynabeads Protein G (Invitrogen, 10004D) were added to each sample and rotated for an additional hour ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein– antibody complexes were visualized using the alkaline phosphatase substrate 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium for color development (Life Technologies).
-
bioRxiv - Genomics 2020Quote: ... 4 × 10−5 % biotin (Life Technologies #B1595), 13.4 g/ l (1.34% (w/v) ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Neuroscience 2023Quote: Cell viability was assayed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Cat. No. M6494, ThermoFisher Scientific, Waltham, MA, USA) to differentiate the range of toxic and nontoxic palmitic acid concentrations ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 vein graft slide containing 2-4 cross sections was double stained with the general macrophage marker Mac-3 (rat anti-mouse, Fisher Scientific, B550292, 1:600) and either iNOS (rabbit anti-mouse ...
-
bioRxiv - Neuroscience 2022Quote: ... forward−5’ AAAACTAGTGAACCGTCAGATCCGCTAG-3’;PspXI (Thermo Fisher Scientific), reverse ...
-
bioRxiv - Microbiology 2021Quote: ... R2 5’-gtgccctttctccatttggt-3’ using superscript III (Invitrogen) and SYBR green (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen, UK) primer sequences comprised part of the Illumina adaptor sequence (underlined) ...
-
bioRxiv - Genomics 2021Quote: ... Reverse UpTag primer 5’ – CACGACGCTCTTCCGATCTAGTANNNNGGGGACGAGGCAAGCTAAGATATC-3’ (Invitrogen, UK) and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... on a QuantStudio 3 or 5 instrument (ThermoFisher). A standard curve of viral RNA of known copy number was run in parallel.
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Immunology 2023Quote: ... then resuspended with 5 uM DiSBAC2(3) (Invitrogen), 2.5 uM DCFDA (AdipoGen Life Sciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by 4’,6diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) staining for 10 min ...
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Life Technologies) was added to visualize cell nuclei ...
-
bioRxiv - Systems Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1× MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-2 drops of CytoSeal mounting media (Thermofisher, 8312-4) was placed on each slide ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1X MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher, 1:5000) were applied in blocking solution for 1h at RT on an orbital shaker ...
-
bioRxiv - Biochemistry 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Acros Organics, ThermoFisher), Magnetic nanobeads (Ocean Nanotech ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, 1:10,000, Invitrogen) was used as a DNA counterstain together with the secondary antibody ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 nM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco) and 50 µM 2-Mercaptoethanol (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Acros Organics, ThermoFisher), Magnetic nanobeads (Ocean Nanotech ...
-
bioRxiv - Neuroscience 2022Quote: ... for 2 days at 4 °C (Invitrogen, both 1:500). After washing ...