Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4–12% Bis-Tris gel (Thermo Fisher Scientific Cat#NP0335BOX) using MES running buffer (Thermo Fisher Scientific Cat#NP000202) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol] and was resolved by SDS-PAGE on 4% to 12% Bis-Tris gels (Invitrogen). Proteins were transferred to a polyvinylidene difluoride immobilon TM-P membrane (Millipore ...
-
bioRxiv - Immunology 2024Quote: ... we injected the mice intraperitoneally with 4 mg/ml of 5-ethynyl-2′-deoxyuridine (EdU) (Invitrogen, Waltham, MA) with the goal of labeling circulating monocytes to assess macrophage retention among groups ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4–12% Bis-Tris gel (Thermo Fisher Scientific Cat#NP0335BOX) using MES running buffer (Thermo Fisher Scientific Cat#NP000202) ...
-
bioRxiv - Microbiology 2022Quote: ... and L plasmids at a ratio of 4:2:2:2:1 using Lipofectamine 2000 (ThermoFisher Scientific). Cells were transfected in 6 well plates and subsequently transferred to T25 flasks with HEp2 cells until cytopathic effect (CPE ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Biochemistry 2024Quote: ... as was 7- Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen™ D346) and CPM stock was prepared at 5 mg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were maintained in a water jacketed 5 % CO2 incubator and passaged every 2-3 days using trypsin/EDTA (Gibco). 1E6 cells were seeded into 6 well plates ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (2◻×◻10-5 M, ThermoFisher), penicillin (100◻IU◻per ml ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM Mg(OAc)2 (Invitrogen), 0.55 mM spermidine (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... and IVH-PHH (Supplementary Figure 2) P7 rats underwent intraventricular injection of 20 µl of 3 kDa Red Dextran Tetramethyl rhodamine (RD/TMR) (D3307, Thermo Fisher Scientific, Waltham, MA), 1.9-nm (1102 ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-triethylammoniumpropyl)-4-(6-(4-(diethylamino) phenyl) hexatrienyl) pyridinium dibromide (FM 4-64; 50 μM) (Invitrogen) or propidium iodide (PI ...
-
bioRxiv - Microbiology 2023Quote: The RBDs of G614, Alpha, Beta, and Omicron (BA.1, BA.2, BA.4/5) variants were ordered as GeneString from GeneArt (Thermo Fisher Scientific). All sequences of the RBD (aa 319-541 in GenBank ...
-
bioRxiv - Physiology 2023Quote: ... and incubated for a period of 1 h in a dark room in 2 ml of extracellular solution containing 5 µM fluo- 4 AM (Thermo Fisher Scientific) or 7 µM Corona Green AM (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Cell concentrations were assessed by acquiring 30 μL of resuspended cells diluted 1:5 in PBS-4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) without any prior washing steps ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 nl solution of 3 μM FM 4-64 (Molecular Probes, Invitrogen) dissolved in DMSO was injected in the otic cavity of 96 hpf zebrafish embryos mounted laterally in low gelling agarose (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 nl solution of 3 μM FM 4-64 (Molecular Probes, Invitrogen) dissolved in DMSO was injected in the otic cavity of 96 hpf zebrafish embryos mounted laterally in low gelling agarose (Sigma) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... samples were diluted 3:1 in 4× NuPAGE LDS sample buffer (Invitrogen) supplemented with 10% beta-mercaptoethanol (v/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... in 4:3:1 ratio into 293FT cells (Thermo Fisher Scientific, #R70007) with Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 µM 3-isobutyl-1-methylxanthine (Thermo Scientific, Cat # 28822-58-4), 1 µM dexamethasone (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a 4:3:1 mass ratio with Lipofectamine 2000 (Invitrogen # 11668019) in a 2:1 ratio of Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... and then loaded with fluorescent Ca2+ probes (3 μM of fura-2 AM or 5.69 μM of Fluo-4 AM, Life Technologies) in HBSS for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... third instar larvae were dissected in zero Ca2+ HL-3 solution at room temperature and stimulated with a HL-3 solution of 90 mM K+/2 mM Ca2+/4 μM FM4-64 (Invitrogen) for 5 min to load FM4-64 dye into the boutons ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were treated with RNAScope H2O2 for 4 min at RT and subsequently washed 2 x 3 min with UltraPure Distilled Water (Invitrogen) at RT ...
-
bioRxiv - Systems Biology 2022Quote: ... Transcriptomics using the isolated mRNA from liver tissues (0, 2, 4, 6, 8 and 10 weeks; n=3 per time point) was performed by Affymetrix GeneChip®Mouse Gene 2.0 ST Arrays (902118) ...
-
bioRxiv - Developmental Biology 2021Quote: ... were crossed for 2-3 days and then transferred to fly food made from 0.6 g of Carolina Formula 4-24 (Fisher Scientific) and 2 mL of ddH2O ...
-
bioRxiv - Genomics 2024Quote: ... and transfer plasmids were transfected at a mass ratio of 2:3:4 with Lipofectamine 3000 (Thermo Fisher Scientific L3000001) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... No mycoplasma were detected in cultures by 4′,6-diamidino-2-phenylindole (DAPI) or TO-PRO-3 (Thermo Fisher Scientific) staining ...
-
bioRxiv - Physiology 2024Quote: ... 2-amino-5-methoxybenzoic acid 1 M (ThermoFisher Scientific) in DMSO ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...