Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for Leucine Rich Repeats And Immunoglobulin Like Domains Protein 3 LRIG3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and 3 mg of protein lysate was incubated with Dynabeads MyOne Streptavidin C1 (ThermoFisher Scientific) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting supernatant samples were run on 3-12% NativePage Bis-Tris Protein Gels (Invitrogen) with addition of NativePage 5% G-250 Sample Additive (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: Constructs encoding harmonin domains were cloned in the pDEST17-vector (Gateway cloning system, Invitrogen, USA). The cDNAs encoding C-terminal tails of Mm JAM-B tail (amino acids 257-299) ...
-
bioRxiv - Bioengineering 2022Quote: ... a C-terminal gp160 trimerization domain and SnoopTagJr) were expressed in suspension Expi293F (Thermo Fisher) and ExpiCHO-S cells respectively and purified as described above for DogCatcher-RBD.
-
bioRxiv - Molecular Biology 2020Quote: ... Plus3 domain point mutations were introduced using the Phusion Site-Directed Mutagenesis kit (ThermoFisher Scientific) and verified by sequencing.
-
bioRxiv - Biochemistry 2023Quote: ... and cDNA encoding GH1D1 domain was subcloned to a modified pET-32a vector (Invitrogen, USA) with an N-terminal TrxA tag and a 6×His tag followed by a TEV protease recognition site ...
-
bioRxiv - Biophysics 2023Quote: Lphn3 GAIN domain constructs were expressed in Expi293 human embryonic kidney cells (Thermo Fisher, A14527) in suspension culture in Expi293 media (Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: The bacterial codon-optimized coding sequence of ZBP1-Zα1Zα2 domains was synthesized (Thermo Fisher Scientific) and subcloned into N terminally His-Tagged pNIC-ZB vector ...
-
bioRxiv - Developmental Biology 2021Quote: Cells were cultured in base medium HyClone DMEM/F12 without Hepes (Cytiva) with 4 mg/mL AlbuMAX™ II Lipid-Rich Bovine Serum Albumin (GIBCO™), 1x MACS NeuroBrew-21 with Vitamin A (Miltenyi Biotec) ...
-
bioRxiv - Cancer Biology 2022Quote: Levels of phosphorylated proline-rich AKT substrate of 40kDa (phospho-PRAS40 (pT246)) were assessed using PRAS40 ELISA kits (Invitrogen, Camarillo, USA, KHO0421). Cells were lysed in extraction buffer (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... immature green fruits and mature red fruits of plants grown in nutrient-rich soil were subjected to total RNA extraction using TRIzol (Invitrogen, Carlsbad, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... SCD ko pools and clones were cultured in DMEM/F-12 with 10% FBS and 0.8 g/L AlbuMAX II lipid-rich BSA (Thermo Fisher Scientific, # 11021029). After infection ...
-
bioRxiv - Immunology 2022Quote: ... Protein A antibody conjugated products were prepared following the protocol of Dynabeads Protein A (Thermo Fisher, 10008D) and incubated with induced yeast libraries at room temperature for 30min with shaking ...
-
bioRxiv - Immunology 2022Quote: ... Protein A antibody conjugated products were prepared following the protocol of Dynabeads Protein A (Thermo Fisher, 10008D) and incubated with induced yeast libraries at room temperature ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: ... Protein-antibody complexes were then captured with the Pierce™ Protein A/G Agarose (ThermoFisher Scientific, #20421) at 4°C for 2 hrs with rotation and beads were then rinsed with wash buffer (25 mM Tris ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were washed in PBS (5 × 3 minutes) and then incubated 3 hours in a cocktail of secondary antibodies conjugated to Alexa Flour dyes (Life Technologies) to tag the primary antibodies at a concentration of 1:500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antibody shifts were done by incubating the protein/extract with 4uL of antibody (α-Twist: Invitrogen PA5-47824 ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were probed with primary antibodies and detected by incubation with HRP-conjugated secondary antibodies (Invitrogen). The following primary antibodies were used ...
-
bioRxiv - Physiology 2020Quote: ... MCF-10 human mammary epithelial cells and COS-7 fibroblast-like monkey cells were maintained in DMEM (Fisher Scientific) supplemented with 10% fetal bovine serum and 2% penicillin/streptomycin.
-
bioRxiv - Microbiology 2021Quote: ... A549 (male, human lung epithelial-like) cells were obtained from ATCC and grown at 37 °C in DMEM (Gibco) supplemented with 10 % FBS (GE Healthcare Life Science ...
-
bioRxiv - Cell Biology 2022Quote: ... ES03 cells were grown on MEF feeders in KSR+bFGF and passaged enzymatically using trypsin-like enzyme (TrypLE, Invitrogen) for at least 3 passages before electroporation ...
-
bioRxiv - Microbiology 2019Quote: ... The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific) using the primers RPA821_NheI (CTAGCTAGCATGACCGACATC ACGACCGAC ...
-
bioRxiv - Microbiology 2021Quote: Green monkey kidney fibroblast-like Cos7 cells were cultured at 37 °C with 5% atmospheric CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... BMEC-like cells in well plates were treated with 10 μM cyclosporin A (CsA; Fisher Scientific #11-011-00), a p-glycoprotein inhibitor ...
-
bioRxiv - Genomics 2021Quote: ... SH-SY5Y neuroblast-like cells were maintained in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12) (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2022Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Immunology 2022Quote: RAW 264.7 murine macrophage-like cells (TIB-71; ATCC) and their derivatives were cultured in RPMI 1640 media (Gibco) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... African green monkey kidney fibroblast-like cell line (COS-7) was maintained in minimal essential medium (MEM, Gibco/BRL) supplemented with 5% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... They were passaged twice weekly by rinsing in phosphate buffered saline and dissociation in Trypsin like-enzyme (ThermoFisher 12604039) before diluting 1:5 into fresh media ...
-
bioRxiv - Molecular Biology 2021Quote: ... we cloned an EcoCas3 cDNA with a octa-histidine tag and a six asparagine-histidine repeat tag into a pFastbac-1 plasmid (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... aliquots of each product were resolved via electrophoresis in agarose gels to confirm amplification of the SVA repeat sequence and then run on the ABI 3730 DNA sequencer (Applied Biosystems) with GeneScan 500 LIZ as internal size standard ...
-
bioRxiv - Genomics 2021Quote: ... we measured total RNA amount (in ng/ul) for 1 million cells in three repeats using the Qubit RNA Broad Range Assay Kit (Life Technologies). The true TmS values of H1092 or CAF were then derived as a ratio of the total RNA amount per cell between the two cell types ...
-
bioRxiv - Biochemistry 2022Quote: ... A non-saturating peptide amount (based on the intensity of the TIC chromatogram) of each biological repeat was injected for LC-MS/MS analysis on a Dionex Ultimate 3000 nano UPLC (Thermo Scientific) coupled to an Orbitrap Fusion Lumos Tribid mass spectrometer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... a program with 6 repeats of bead beating at 4.5 m/sec was performed for 45 seconds using the FastPrep-24™ 5G (Thermo Fisher). Samples were incubated for two minutes on ice after the third repeat ...
-
bioRxiv - Microbiology 2023Quote: ... 3 repeats of bead beating at 4.5 m/sec was performed for 45 seconds using the FastPrep-24™ 5G (Thermo Fisher) and the final elution volume was decreased to 40 μL.
-
bioRxiv - Biophysics 2023Quote: ... University of Belgrade-Faculty of Biology which was previously produced by several reactions of cloning and subcloning of CTG repeats originating from human DMPK locus using pJet1.2/blunt cloning vector from CloneJET PCR Cloning Kit (Thermo Fisher Scientific). The subcloned region sequence was verified with Sanger sequencing before prior use ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were washed 3 times in PBS and secondary antibodies (Oregon Green - Thermofisher O-6382 ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibody incubation was performed for 3-4 days and DiD (Thermo Fisher Scientific-Molecular Probes L7781 ...
-
MK2 deficiency decreases mortality during the inflammatory phase after myocardial infarction in micebioRxiv - Physiology 2023Quote: ... Mouse monoclonal antibodies against GAPDH (glyceraldehyde 3-phosphate dehydrogenase) (# 4300) were from Ambion. Secondary antibodies conjugated with horseradish peroxidase were from Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Molecular Biology 2023Quote: ... and primary antibodies for 3 days: chicken anti-GFP (1:750, Thermo Fisher Scientific Cat# A10262 ...
-
bioRxiv - Developmental Biology 2023Quote: ... species-specific secondary antibodies (Life Technologies; 1:300 dilution in 3% BSA/PBS). Images were collected on a Zeiss Axioimager.D2 upright microscope using a 63x/Plan-neofluar objective and captured using a Coolsnap HQ2 camera (Photometrics ...
-
bioRxiv - Cell Biology 2024Quote: ... and probed with desired antibody in 3% BSA TBST (BSA, BP9703100, Fisher Scientific) overnight at 4C ...
-
bioRxiv - Cell Biology 2020Quote: ... protein lysates were immunoprecipitated with anti-GFP antibody conjugated to protein A-coupled polyacrylamide beads (#53142 Thermo Scientific) for 2 h at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... “Protein extracted” with T7 tag antibodies were incubated with protein A containing magnetic beads (Dyna beads, Thermo fisher) for 2 hours at 4 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Beads were prepared by incubating them in 0.5% BSA in PBS and antibodies overnight (100µL of Dynabeads Protein A or Protein G (Invitrogen) plus 20µL of antibody) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Beads were prepared by incubating them in 0.5% BSA in PBS and antibodies overnight (100μL of Dynabeads Protein A or Protein G (Invitrogen) plus 20μL of antibody) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The antibody-DNA complex was precipitated with protein A/G magnetic beads or protein A sepharose beads (Invitrogen). After washing ...
-
bioRxiv - Immunology 2023Quote: ... Protein-antibody complexes were immunoprecipitated by rotating the samples with 40 μL protein A-agarose beads (ThermoFisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2023Quote: ... The antibody-protein complex was recovered with protein A coupled to magnetic beads (Dynabeads, Invitrogen, Cat No. 10002D), followed by extensive washes with low salt immune complex wash buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The antibody-binding proteins were pulled down using protein A conjugated magnetic beads (Thermo Scientific, Cat No.88845) and washed by repeated centrifugation and homogenization ...