Labshake search
Citations for Thermo Fisher :
5351 - 5400 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: To generate construct drg1 [prab-3∷GCaMP6m∷NLS∷unc-54 3’UTR] we performed a 4-way Gateway recombination reaction using LR Clonase II (Invitrogen). We recombined pDEST II with the following entry clones ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lipophilic dye DiL (DilC18(3) (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate) at 1mM stock in ethanol (Invitrogen; Carlsbad, CA, USA) was used to label nanoparticles to observe in vitro delivery ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... all used viruses were propagated to passage 3 on Calu-3 (ATCC HTB-55) cells in Advanced DMEM/F12 (Gibco), supplemented with HEPES ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The carboxylic groups on the carbon fiber surface were electro-activated by incubation in 0.4 M 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC; Life Technologies) and 0.1 M and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Neuroscience 2023Quote: ... and loaded with the Fluorescent Dye-Based Rhod-3 AM following the manufactures’ instructions (Rhod-3 Calcium Imaging Kit, Cat.No. R10145; ThermoFisher scientific). Loading ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Cat. A638729) were purchased from Aladdin (Shanghai). KLH (Cat. 77600) was purchased from ThermoFisher. Peptide synthesis was conducted by Genscript (Nanjing ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Neuroscience 2023Quote: ... a 5040 amperometric cell and a Hypersil Gold C18 analytical column (3 μm, 100 × 3 mm; Thermo Fisher Scientific, USA). The mobile phase consisted of 0.1 M KH2PO4 buffer at pH 3.8 ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Genomics 2023Quote: ... A single-cell suspension from PBMC from each patient was quantified and analyzed for viability using the Cell counter 3 (Countess 3, Invitrogen) and then loaded onto the 10X Genomics Chromium Single Cell Controller for isolation of single cells (10X Genomics) ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase 3/7 activity was assessed using the CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Scientific, #C10427) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Systems Biology 2020Quote: ... An Ion Torrent PGM was used with the Hi-Q 400 template preparation and sequencing kit and a 318v2 sequencing chip (Thermo Fisher, MA). All the quality control steps were performed using Bioanalyzer 2100 (Agilent ...
-
bioRxiv - Molecular Biology 2019Quote: The pFastBacNKI-his-3C-m6A-Tracer construct was used for creation of baculovirus according to the Bac-to-Bac system (Thermo Fisher Scientific). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... of 8 mice were then resuspended in 10 ml DMEM supplemented with 10 % heat inactivated new born calf serum (HI NCBS, LifeTechnologies / Gibco, # 26010-074) and plated on two 10 cm dishes (Corning ...
-
bioRxiv - Genetics 2021Quote: One microliter of GlobalFiler™ or GlobalFiler™ Express amplified product was added to 9.5 μL Hi-Di™ formamide (ThermoFisher Scientific) and 0.5 μL GeneScan™ 600 LIZ® size standard (ThermoFisher Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: ... the SBT3.8 ORF was amplified from genomic DNA with a reverse primer including six His codons and first cloned into pCR2.1-Topo (Life Technologies, Carlsbad, CA). EcoRI sites from pCR2.1 were used for ligation into pART7 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Libraries were then pooled and loaded onto chips and sequenced on Ion Torrent PGM using Ion PGM Hi-Q Sequencing Kit (Thermo Fisher Scientific). Fast-q or BAM files from sequencing runs were analysed in Geneious ...
-
bioRxiv - Plant Biology 2019Quote: ... with induction by 0.5 mM IPTG (Isopropyl β-D-1-Thiogalactopyranoside, 16°C, 12 h) and then purified using Ni-NTA His binding resin (Thermo Scientific) according to the manufacturer’s manual ...
-
bioRxiv - Immunology 2019Quote: ... PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen, Carlsbad, CA, USA). CD16158F-CR and CD32131R-CR were subcloned into NcoI and MluI sites of the SFG retroviral vector ...
-
bioRxiv - Biophysics 2019Quote: ... the MerMAID1 gene was subcloned with a C-terminal TEV protease restriction site and a 6× His-Tag into the pPiCZ vector (Invitrogen, Carlsbad, CA). Zeocin™-resistant positive clones were selected from electroporation-transformed yeast cells ...
-
bioRxiv - Cell Biology 2019Quote: ... conjugated with GFP at the C-terminus (Par-6-GFP and aPKC-GFP) was inserted into pAc5.1/V5-His B plasmid (Invitrogen, Thermo Fisher Scientific). To construct an expression vector for Par-3 under control of the Gal4-UAS system ...
-
bioRxiv - Genetics 2019Quote: ... using 1 μl PCR product in 9.5 μl Hi-Di™ formamide containing 0.5 μl GeneScan™ 600 LIZ® Size Standard v2.0 (Thermo Fisher Scientific). One microliter of allelic ladder was included per 24 sample injection ...
-
bioRxiv - Bioengineering 2021Quote: ... THP-1 cells were expanded in RPMI medium (ATCC® 30-2001™) supplemented with 10% heat inactivated fetal bovine serum (HI-FBS, Gibco, ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: S1R was expressed with an N-terminal 6*His-tag fusion in Sf9 cells using Bac-to-Bac baculoviral expression system (Thermo Fisher Scientific) according to manufacturer’s recommendations ...
-
bioRxiv - Bioengineering 2020Quote: The Taq polymerase-amplified PCR product of the rdLRP was inserted into the TOPO Cloning site of a pcDNA3.1/V5-His-TOPO vector (Thermo Fisher Scientific, MA). The vector was transfected to 6×105 cells of HEK293T cells using Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2020Quote: ... the GST-Tagged proteins were eluted with 15 mM GSH (Bio-basic) and cleaved in solution using purified recombinant His-Tagged TEV protease (Thermo Fisher Scientific). Tag-free NCK2 proteins were further purified using a 1 ml HisTrap FF column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: The full-length OpIE2 promoter was obtained from the pIB/V5-His by PCR using Phusion High fidelity DNA Taq polymerase (ThermoFisher Scientific, USA) according to the following program ...
-
bioRxiv - Biophysics 2022Quote: ... followed by an 8× His tag and HRV 3C protease cleavage site was cloned into the modified pFastBac1 (Invitrogen, Carlsbad, CA, USA) vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... The sequencing was performed on Ion 318 v2 chip and Ion Torrent PGM machine employing the Ion PGMTM Hi-QTM View Sequencing kit (Life Technologies, USA). All procedures were carried out according to manufacturer’s instructions and each run was expected to produce approximately 150,000 reads per sample ...
-
bioRxiv - Microbiology 2022Quote: ... and Omicron RBD-his protein were coated overnight at 4 °C in a 96-well plate (MaxiSorp Nunc-immuno, Thermo Scientific, USA). Wells were blocked with 5% non-fat milk (Biofroxx ...