Labshake search
Citations for Thermo Fisher :
5301 - 5350 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... 40 μl of total blood were stained with a fluorescent lipophilic dye (3, 3′-dyhexiloxacarbocyanine iodide; DiOC6, Molecular Probes) to obtain absolute counts of erythrocytes ...
-
bioRxiv - Cancer Biology 2024Quote: ... was injected into buccal mucosa of tumor-bearing KOG mice 3 times every 3 days along with 100 μg polyI:C (Invitrogen) as adjuvant.
-
bioRxiv - Biophysics 2021Quote: ... The recombinant constructs of heavy and light chain were transfected at 1:1 ratio into Expi293F™ cells using the ExpiFectamine™ 293 Transfection Kit (Gibco™, Thermo Fisher Scientific, Waltham, MA, USA). 4-5 days after transfection the antibodies were purified from the supernatant by protein A affinity resin (ProSep®-vA ultra ...
-
bioRxiv - Genomics 2021Quote: ... Lysates and positive technical controls (Human Universal Reference RNA - uhrRNA Agilent Cat# 740000, Santa Clara, California and Human Brain Total RNA brRNA - ThermoFisher AM7962, Waltham, Massachusetts), as well as no-cell negative controls (1X TempO-Seq lysis buffer alone ...
-
bioRxiv - Immunology 2020Quote: The assay to measure total IgG was modified to measure IgG subclass responses at 1/100 including a two-step biotinylated anti-human IgG subclass (mouse anti-human IgG1: HP6069, IgG2: HP6002, IgG3: HP6050 IgG4: HP6023, Thermo fisher Scientific, UK) with a streptavidin-Phycoerythrin tertiary (Thermo fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... Samples were run on the Clariom™ S Human Array to measure gene expression at >20,000 genes in the human genome (Affymetrix, Santa Clara, CA). Raw data generated from the arrays were read into R statistical software (version 3.5.1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Alexa Fluor™ 488-Human Transferrin conjugate (Cat# T13342) and DiI–human LDL conjugate (Cat# L3482) were obtained from Molecular Probes (Eugene, OR). Primer kits and Master Mix for RT-qPCR were purchased from Applied Biosystems (Foster City ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA levels were normalized to non-human primate β-actin (Table S1) or human β-actin (Hs99999903_m1, Applied Biosystems; Thermo Fisher Scientific) and calculated by the ΔΔCt method [46].
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA levels were normalized to non-human primate β-actin (Table S1) or human β-actin (Hs99999903_m1, Applied Biosystems; Thermo Fisher Scientific) and calculated by the ΔΔCt method [46].
-
bioRxiv - Immunology 2021Quote: PBMC derived CD4+ T cells were isolated from HIV-infected MACS participants using EasySep™Human CD4+ T Cell Isolation Kit and activated overnight with Human T-Activator CD3/CD28 Dynabeads® (Life Technologies). The next day Dynabeads were separated from the CD4+ T cells by manual dissociation followed by magnet isolation ...
-
bioRxiv - Immunology 2021Quote: ... CD4+ and CD8+ T cells were isolated by negative selection with the Dynabeads Untouched Human CD4 T Cells Kit and the Dynabeads Untouched Human CD8 T Cells Kit (Invitrogen, Thermo Fisher Scientific) respectively ...
-
bioRxiv - Cell Biology 2022Quote: Human cerebral organoids are generated from human induced pluripotent stem cells (iPSCs) which were purchased from GibcoTM (Gibco by Thermofisher, Waltham, Massachusetts, USA). iPSCs were plated in a dish pre-coated with Matrigel® hESC-Qualified Matrix (Corning ...
-
bioRxiv - Cell Biology 2023Quote: We profiled the expression of transcripts in human aortic vascular smooth muscle cells using the Clariom D human DNA microarray (Thermo Fisher Scientific Inc.). This platform includes information from probe sets representing known and predicted exons and introns on both strands of the genome that have been mapped to more than genes ...
-
bioRxiv - Immunology 2023Quote: Customized cytokine 25-Plex Human ProcartaPlex Assay (customized from Cytokine 25-Plex Human ProcartaPlex Panel 1B with the catalog # EPX250-12166-901, Thermo Fisher Scientific, USA) was used to measure multiple cytokines in the supernatants of stimulated human PBMCs.
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Immunology 2021Quote: ... iBMDMs were incubated for 3 h in 50 μM of the mitochondrial uncoupler carbonyl cyanide 3-chlorophenylhydrazone (CCCP; ThermoFisher, M20036). Control samples included ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: The wild-type copy of the xopX gene and its 14-3-3 protein binding motif mutants were cloned in the yeast two-hybrid vector pDEST32 (Invitrogen) using the Gateway cloning system (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... supplemented with 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindocarbocyanine (DiI)-labelled acetylated-LDL (15µg/ml, Thermo Fischer) or DiI-labelled LDL (15 µg/ml, Thermo Fisher) and incubated at 37°C for 2 hours ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Systems Biology 2021Quote: ... The Caspase-3 assay was performed on retina sections following the protocol described above (anti-caspase 3 (Fisher Scientific, 15889738) 1:500) ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA biotinylation at the 3′ end was performed using the Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific, US) in accordance with the manufacturer’s instructions with some modifications ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Biophysics 2022Quote: ... Texas Red-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanloamine (TR-DHPE) and Oregon Green-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (OG-DHPE) were purchased from Thermo Fisher. PLL-PEG and PLL-PEG-biotin were purchased from SuSoS AG ...
-
bioRxiv - Biophysics 2022Quote: ... Cryo-EM grids were imaged using SerialEM44 with a 3×3 image shift collection (with calibrated correction for image shift induced beam tilt) on a Titan Krios (ThermoFisher) equipped with a K3 camera and a Bioquantum energy filter (Gatan ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Molecular Biology 2022Quote: ... HDAC BamHI_FP: 5’-CGCGGATCCATGTCTAATAGAAAAAAGGTTGC-3’,and HDAC_XhoI_RP: 5’-CCGCTCGAGTTAATATGGTACAATAGATTGATCC-3 with Phusion™ High-Fidelity DNA Polymerase (Thermo Scientific, US). The amplified DNA fragment was purified with QIAquick Gel Extraction Kit (Qiagen ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Neuroscience 2022Quote: Full length mouse Unkempt was amplified from cDNA using primers 5’-CACCAGATATCCAATGTCGAAGGGCCCCGGGCCCG-3’ and 5’-GACGACTCTAGATCACGACTGGAGGGCATGGGCCC-3’ and cloned into pENTR/D-TOPO (ThermoFisher) according to the manufacturer’s instructions to create pENTR-Unk ...
-
bioRxiv - Genetics 2022Quote: ... of a PCR amplified region of the rgr-1 locus using OneTaq 2x Master Mix (forward primer DLO1140 5’-TGGAATGGGACTTCCTCTTG-3’ reverse primer DLO1141 5’-TTTCCAAAAGCCAGGACATC-3’) isolated using a GeneJET PCR Purification kit (ThermoFisher). The rgr-1(gk429013 ...
-
bioRxiv - Immunology 2022Quote: ... burgdorferi strain B31-5A4 using the primers ((BBRecAfp (5’-GTGGATCTATTGTATTAGATGAGGCTCTCG-3’) and BBRecArp (5’-GCCAAAGTTCTGCAACATTAACACCTAAAG-3’)) with qPCR using an Applied Biosystems 7500 Real-Time PCR system (ThermoFisher) in conjunction with PowerUp™ SYBR® Green Master Mix (ThermoFisher ...
-
bioRxiv - Genomics 2019Quote: ... The 3’ end of the Ppetra cDNAs were determined with the 3 RACE System for Rapid Amplification of cDNA Ends (Invitrogen); the 5’ end of the Ppetra cDNA was determined with the 5’/3’ RACE kit 2nd generation (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: Proliferating hNPCs (n=3) or differentiating immature neurons (n=3) CTX0E16s were pelleted and lysed in TRI Reagent (Ambion, AM9738). Total RNA was then extracted per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 25 μl/well of 60 mM water solution of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Thermo Fisher Scientific) were added ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was end labelled at the 3’ end with biotin using the Pierce RNA 3’ End Biotinylation Kit (Thermo Fisher). RNA quantity was assayed by running an RNA 6000 Nano chip on a 2100 Bioanalyzer ...
-
bioRxiv - Cancer Biology 2020Quote: mRNA associated with 1 to 3 ribosomes “Light polysomes” and mRNA associated with more than 3 ribosomes “Heavy polysomes” were extracted using TRIzol LS (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Molecular Biology 2019Quote: ... or for pre- and mature mRNAs (far-3, ZK970.7) or for pre-mRNA only (eft-3) and using StepOnePlus Real-time PCR Systems (Applied Biosystems) according to the suppliers’ protocols ...