Labshake search
Citations for Thermo Fisher :
5251 - 5300 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Microarray expression data (Affymetrix Human Gene 2.0 ST arrays) from Nicolle et al ...
-
bioRxiv - Biophysics 2023Quote: ... media-washed human activator CD3/CD28 Dynabeads (Gibco, USA) were added at a 1:1 cell-to-bead ratio ...
-
bioRxiv - Immunology 2023Quote: ... PE-Cy7 anti-human C27 (clone O323, ThermoFisher Scientific), AlexaFluor 700 anti-human CD38 (clone LS198-4-3 ...
-
Metabolic specialization drives reduced pathogenicity in Pseudomonas aeruginosa CF clinical isolatesbioRxiv - Microbiology 2023Quote: ... previously coated with human type I collagen (Gibco, A1048301). ALI was established once cells reached full confluency by removing media from the apical chamber and replacing media in the basolateral chamber with Pneumacult-ALI maintenance medium (STEMCELL Technologies ...
-
Tight junction membrane proteins regulate the mechanical resistance of the apical junctional complexbioRxiv - Cell Biology 2023Quote: ... rabbit polyclonal anti-human JAM-A (Invitrogen; #PA5-120157); rabbit polyclonal anti-CAR (kindly provided by Jeffrey M ...
-
bioRxiv - Molecular Biology 2023Quote: Human HEK293T cells (ATCC) were maintained in DMEM (Gibco) supplemented with 10% heat inactivated FBS (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... 50 ng/mL human IL-21 (Thermo Fisher Scientific), 50 ng/mL human IL-4 (Miltenyi) ...
-
bioRxiv - Systems Biology 2024Quote: ... ANXA1 (rabbit anti-human, 1:1000, ThermoFisher Scientific, UK), phosphotyrosine-21 ANXA1 (rabbit anti-human ...
-
bioRxiv - Cell Biology 2024Quote: ... or two siRNAs targeting human PLA2G15 (ThermoFisher s24296, s24297) using RNAiMax (ThermoFisher ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the human σ2 receptor was cloned into pcDNA3.1 (Invitrogen) mammalian expression vector with an amino-terminal protein C tag followed with a 3C protease cleavage site and transfected into Expi293 cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... for human HTT and Alexa fluor 647 (Thermofisher # B40958) for mouse Htt ...
-
bioRxiv - Neuroscience 2024Quote: ... AT8 human PHF-Tau (Thermo Scientific, MN1020, 1:250). The following secondary antibodies were used ...
-
bioRxiv - Cancer Biology 2024Quote: ... rabbit anti-human CD3 (clone SP7, Thermo Fisher Scientific); sheep anti-human CD34 (#AF7227-SP ...
-
bioRxiv - Bioengineering 2024Quote: Human dermal fibroblast (HDF) cells (C0135C; ThermoFisher Scientific, UK) were cultured in flasks with Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Microbiology 2024Quote: ... Goat anti-human IgG (H+L) (Thermo Fisher Scientific) pre-coupled to Alexa Fluor 647 were used as secondary antibodies in flow cytometry experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... in 2 mL complete human medium (DMEM/F12 [Gibco, Massachusetts ...
-
bioRxiv - Immunology 2024Quote: ... Dynabeads™ Human T-Activator CD3/CD28 (ThermoFisher Scientific) were added to the culture ...
-
bioRxiv - Microbiology 2024Quote: ... Goat anti-human IgG (H + L) (Thermo Fisher Scientific) or Goat anti-Human IgG Fc recombinant (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... Human PA-1 cells were cultured in MEM (Gibco) supplemented with GlutaMAX ...
-
bioRxiv - Neuroscience 2024Quote: ... human astrocytes at P4 (K1884, Thermo Fisher Scientific Gibco) were seeded in each well ...
-
bioRxiv - Neuroscience 2024Quote: ... human astrocytes at P4 (K1884, Thermo Fisher Scientific Gibco) were seeded in each well ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... (Telangana, India) with human suspension hepatocytes (HMCS1S, Gibco USA). 200 µL of cell suspension containing 2 x 106 hepatocytes/mL (>95% viability ...
-
bioRxiv - Cell Biology 2024Quote: ... primary human islets were first dissociated with TrypLE (Gibco) prior to incubation with a mouse monoclonal anti-human NTPDase3 antibody (Ectopeptidases ...
-
bioRxiv - Cell Biology 2020Quote: ... Endoplasmic reticulum (ER) was labeled with DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, aka DiIC18(3)) (Thermo Fisher #D282) or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: Caspase-3-like activity was quantified using the EnzChek Caspase-3 Assay kit #1 (Molecular Probes, Eugene, OR, USA). Tissue samples were thawed on ice for 5 min ...
-
bioRxiv - Neuroscience 2019Quote: ... cortical cultures were loaded with fluo-4 AM (3 μM) or fura-2 AM (3 μM) plus 0.1% Pluronic F-127 (ThermoFisher) in a HEPES-buffered saline solution (HCSS ...
-
bioRxiv - Biochemistry 2020Quote: Cultivated Jurkat cells were collected and washed 3 times in flow buffer (PBS without Ca/Mg, 3% FBS, Gibco). Cell concentration was measured ...
-
bioRxiv - Cancer Biology 2020Quote: ... TIC-enriching 3-D cultures (3-D) were maintained in stem cell media: DMEM:F12 (+ L-glutamine, + 15 mM HEPES) (Gibco) supplemented with 1% penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reactions were run on the QuantStudio 3 and analyzed on the QuantStudio 3 Design and Analysis software v1.5.1 (ThermoFisher Scientific). Quantitation and normalization of relative gene expression were accomplished using comparative threshold cycle method or ΔΔCT.
-
bioRxiv - Cell Biology 2021Quote: Total RNA from control (n=3) and model (n=3) Huh7 cells were isolated by TRIZOL reagent (Thermo Scientific), and the RNA concentration ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then lysed and a caspase-3 assay was performed according to the manufacturer’s protocol (EnzChek caspase-3 Assay, Invitrogen). The intensity of fluorescence was analyzed using an EnVizion plate reader.
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Developmental Biology 2020Quote: RNA from Rbx2 fl/fl (n=3) and Rbx2cKO-Nes (n=3) P1 telencephalons was extracted using TRIzol (Invitrogen). Strand-specific and barcode-indexed RNA-seq libraries were generated from 1 μg total RNA each after poly-A enrichment using the Kapa Stranded mRNA-seq kit (KapaBiosystems ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Bioengineering 2019Quote: ... The resulting VH-(G4S)3-VL ScFv fragment was further fused at the N-terminus of the murine TNF gene through a S4G-linker and the final construct VH-(G4S)3-VL-(S4G)3-TNF was then cloned into the mammalian expression vector pcDNA3.1 (+) vector (Invitrogen). A VH-(G4S)3-VL ScFv fragment specific for hen egg lysozyme (KSF)(34) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Immunology 2020Quote: 3’ RACE analysis was performed on testis and liver RNA using the 3’ RACE System kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Detection of active caspase 3/7 was accomplished using CellEvent™ Caspase-3/7 Red Detection Reagent (ThermoFisher Scientific). Sorted CD4SP Rag1GFP+ thymocytes were stained with CD5-PerCP-Cy5.5 (53-7.3 ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Physiology 2024Quote: ... 40 μl of total blood were stained with a fluorescent lipophilic dye (3, 3′-dyhexiloxacarbocyanine iodide; DiOC6, Molecular Probes) to obtain absolute counts of erythrocytes ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3′-ligated RNA fragments and subtracted 3′-ligated RPF fragments were reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen) at 48 °C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: Total mRNA from 3 CT-PAK2EC and 3 KO-PAK2EC average-sized tumors was extracted using TRIZOL reagent (Invitrogen) according to recommended procedures ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...