Labshake search
Citations for Thermo Fisher :
5251 - 5300 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The abundance of mRNA was measured by quantitative real-time PCR analysis using the SYBR Green PCR Master mix (Applied Biosystems). PCR was carried out with 96-well plate using Applied Biosystems 7500 Real-Time PCR Systems ...
-
bioRxiv - Microbiology 2023Quote: Real-time PCR was performed by standard TaqMan Assay on either the QuantStudio 7 or Quantstudio 5 Real-Time PCR platform (Applied Biosystems). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA product was further diluted 1:4 in nuclease-free water and 2 μl were used in a 15 μl total reaction for qRT-PCR (7500 Fast Real-Time PCR instrument; Applied Biosystems), using SYBR green as nucleic acid stain (Roche 4913850001) ...
-
bioRxiv - Immunology 2023Quote: ... DNA products were used for real time qRT-PCR reaction using the TaqMan 2X Universal PCR Master Mix (Thermo Fisher Scientific) on an iQ5 RT-PCR detection system (BioRad ...
-
bioRxiv - Molecular Biology 2023Quote: ... qRT PCR was performed as described previously (Li et al, 2018) using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). SsoFast EvaGreen Supermixe (Takara ...
-
bioRxiv - Immunology 2023Quote: ... The concentration of libraries was measured by an ABI PRISM 7500 Real-time PCR system in combination with a Power SYBR Green PCR Master Mix (Thermo Fisher). Single-end sequencing of cDNA libraries with a read length of 51 was performed with HiSeq 1500 platform (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Relative quantitation of mRNAs was carried out via SYBR green-based quantitative PCR using a Quantstudio 3 Real-time PCR system (Applied Biosystems). PCR results were analyzed using the 2-(ΔΔCT ...
-
bioRxiv - Cancer Biology 2023Quote: ... according to the manufacturer’s instructions with qRT-PCR performed using SYBR Green Master Mix (SparkJade) using a StepOnePlus™ real-time PCR intrument (ThermoFisher). Fat1 levels were measured using forward (5′ GGACCAGCATCGCAAGAGTC 3′ ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed in triplicate using PerfeCTa SYBR Green FastMix (Quantabio) and a QuantStudio 5 Real-Time PCR machine (Applied Biosystems), and the results were computed relative to a standard curve made with cDNA pooled from all samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 ng of digested/undigested DNA was then quantified by real time PCR using a 7500 FAST Applied Biosystems thermocycler with SYBR Green PCR Master Mix (Applied Biosystems) and 100 nM of primer in a 20 μl reaction ...
-
bioRxiv - Microbiology 2024Quote: ... and 1 µL was used as template for quantitative PCR (qPCR) using PowerUp SYBR green master mix (Applied Biosciences) on a ViiA7 real-time PCR machine (Applied Biosystems), following the manufacturer’s suggested protocol ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... and RT-PCR (Invitrogen; 18064014), respectively ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR (Applied Biosystems) was performed on cDNA samples for Ccl19 ...
-
bioRxiv - Cancer Biology 2024Quote: ... miR-scrambled and anti-miR-scrambled obtained from Invitrogen™ mirVana™ (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pHAGE-TO-HSA-P2A-dCas9 or pHAGE-TO-HSA-P2A-dCas9-KRAB) using Lipofectamine 2000 (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative RT-PCR was performed using the Power SYBR Green PCR Master Mix Kit (Applied Biosystems) on a 7500 Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Pathology 2019Quote: ... SYBR® Green PCR Master Mix and RT-PCR Reagents kit (Applied Biosystems, Foster city, USA) were used to do real time PCR on an ABI 7500 FAST REAL TIME PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2019Quote: ... Quantitative RT-PCR was performed with a SuperScript III Platinum One-Step qRT-PCR Kit (Thermofisher) in a CFX96 Touch Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR was performed with the SuperScript III Platinum One-Step qRT-PCR Kit (Invitrogen) using a Step One Plus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2019Quote: ... Quantitative RT-PCR was performed using the ABI PRISM 7900 sequencing detection system (Applied Biosystems, Foster City, CA, USA) with SYBR green master mix under the following conditions ...
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA was quantified by RT-qPCR with the AgPath-ID One Step RT-PCR KIT (Thermo Fisher), using the forward primer 5’ - ATC TGA CAA CGG AAG GTG GG – 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... Paris using Ag Path-ID One-Step RT-PCR kit® (Thermofisher). PCR reaction was run on the ABI PRISM® 7900 system (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reverse transcription was performed with the Superscript III RT-PCR Kit (Invitrogen). Quantitative PCR was performed with the SYBR Green PCR Master Mix using the ABI StepOnePlus Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... One-Step RT-PCR SuperScript™ III Platinum™ Kit (Life Technologies) was used for virus detection ...
-
bioRxiv - Microbiology 2021Quote: ... Using a SuperScript III One-Step RT–PCR kit (Thermo Fisher Scientific), the RT-PCR product (596 bp ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed using the SuperScript III Reverse Transcriptase kit (ThermoFisher) with oligo(dT)20 primer.
-
bioRxiv - Neuroscience 2022Quote: ... 2μg of cDNA prepared using a 2-step RT-PCR kit (Invitrogen) was used in 28 cycles of PCR with PlatinumTaq (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... RT-PCR was performed using the PowerUP SYBR Green Kit (Thermo Fisher) and the QuantStudio 5 Real-Time PCR Detection System (Thermo Fisher) ...
-
bioRxiv - Microbiology 2024Quote: ... using the AgPath-ID One-Step RT-PCR kit (Thermo Fisher Scientific) with target-specific primers ...
-
bioRxiv - Immunology 2020Quote: ... Chambers were rinsed three times with PBS after which RPMI-HSA containing 1 µM To-pro-3 (Thermofisher) was added ...
-
bioRxiv - Genomics 2024Quote: ... We then compared the performance of the different kits in terms of detection and quantification rates using standard RT-PCR (Applied Biosystems 7500 Fast Instrument, Thermo Fisher) and portable RT-PCR (Magnetic Induction Cycler quantitative PCR (Mic qPCR) ...
-
bioRxiv - Bioengineering 2023Quote: ... Quantitative real-time RT-PCR (qRT-PCR) was performed with duplicates on a MicroAmp™ Fast Optical 96-Well Reaction Plate (Themo Fisher Scientific) using the QuantStudioTM 5 Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting complementary (c)DNA was used for quantitative real-time PCR (qRT-PCR) using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) on a StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was quantified by quantitative PCR on an ABI Prism 7500 real-time PCR system using Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies, Carlsbad, CA, USA) and primers amplifying a fragment of DHX37 transcript (forward 5’-CCCGATATCGAGAAAGCCTGG-3’ ...
-
bioRxiv - Microbiology 2019Quote: Quantitative reverse transcription-PCR (qRT-PCR) analysis of the metabolically active community was achieved with the StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA USA). Amplification reactions were in ...
-
bioRxiv - Developmental Biology 2024Quote: ... and qRT-PCR was conducted on a Bio-Rad CFX96 real-time PCR machine using SYBR Green PCR Master Mix (Thermo Fisher Scientific, catalog no. 4309155), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... a 663-bp RT-PCR product was amplified from extracted RNA using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA). A 20-μl reaction was assembled in PCR 8-tube strips through the addition of 10 μl 2× reaction mix ...
-
bioRxiv - Microbiology 2020Quote: 400-500 bp of RT-PCR product were synthesized and amplified from extracted RNA using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA). 20μl reactions were assembled in PCR 8-tube strips through the addition of 10μl 2X reaction mix ...
-
bioRxiv - Neuroscience 2020Quote: ... using a StepOnePlus Real-time instrument (ThermoFisher). Intron-spanning primers were designed to specifically quantify targeted mRNA transcripts ...
-
bioRxiv - Neuroscience 2019Quote: ... using a StepOnePlus Real-time instrument (ThermoFisher). Intron-spanning primers were designed to specifically quantify targeted mRNA transcripts ...
-
bioRxiv - Plant Biology 2020Quote: ... was performed on 15 ng cDNA were used for real time qPCR amplification with the ABI Prism 7300 sequence detection system (Applied Biosystems), using iQSYBR Green Supermix (Biorad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative real-time qPCR analysis was carried out using an ABI PRISM 7500 Sequence Detection system (Applied Biosystems, New York, USA) with SYBR Green (TaKaRa Bio ...
-
bioRxiv - Plant Biology 2019Quote: ... Real-time qPCR was performed in an optical 96-wells plate with a StepOne sequence detection system (Applied Biosystems, Life Technologies) and fast cycling conditions (20 s at 95°C ...
-
bioRxiv - Plant Biology 2019Quote: ... Real-time qPCR was performed in an optical 96-wells plate with a StepOne sequence detection system (Applied Biosystems, Life Technologies) and fast cycling conditions (20 s at 95°C ...
-
REGN-COV2 antibody cocktail prevents and treats SARS-CoV-2 infection in rhesus macaques and hamstersbioRxiv - Microbiology 2020Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using the StepOnePlus Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) with SYBR Premix EX Taq kit (Takara Biotechnology Co. ...
-
bioRxiv - Cancer Biology 2021Quote: ... and after 40 cycles were analyzed on an QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Neuroscience 2019Quote: ... and experiments were run on an AB7900HT fast real-time PCR instrument (Applied Biosystems, Foster City, CA). Each data point represents an average of three replicates ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cycles for library amplification was determined using 7900HT Fast Real-Time PCR System (Applied Biosystems™). The amplification buffer and enzyme mixes provided in library kit was used for the master mix together with EvaGreen for qPCR (Biotium).
-
bioRxiv - Microbiology 2019Quote: ... and the increasing fluorescence intensity were detected by the real-time PCR system 7500 Fast (Applied Biosystems). Data was indicated as a relative ratio between minimum and maximum intensity of SYPRO orange from 25 to 95°C detected at each sample.