Labshake search
Citations for Thermo Fisher :
5201 - 5250 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... in ultrapure water and subjected to real-time PCR using an Applied Biosystems Model 7900HT with TaqMan Universal PCR Mastermix (Applied Biosystems) with the following probes ...
-
bioRxiv - Genomics 2021Quote: ... Quantitative PCR was carried out on a Step One Plus Real-Time PCR System using Fast SYBR Green Master Mix (Applied Biosystems).
-
bioRxiv - Genetics 2020Quote: ... Quantitative PCR was done with an Applied Biosystems StepOne Plus Real-Time PCR system with Power SYBR Green PCR Master Mix (Applied Biosystems) per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Samples were analyzed by quantitative PCR (qPCR) performed with the 7500 Fast Real Time PCR System with Fast SYBR Green Master Mix (Applied Biosystems). qPCR conditions used ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... We ran all qRT-PCR experiments in duplicate on the StepOnePlus™ Real-Time PCR System (Applied Biosystems, Waltham, MA, USA).
-
bioRxiv - Cell Biology 2020Quote: ... The amounts of short and long Mad2 mRNAs were quantified by using a real-time PCR system with SYBR green PCR Master Mix (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Standard PCR amplification was performed in triplicate on a Step One Plus Real-Time PCR System (Applied Biosystems; Grand Island, NY) in a final volume of 20 μL containing ∼10 ng of cDNA (1.5 μL of RT product) ...
-
bioRxiv - Pathology 2021Quote: ... qPCR analysis of gene expression was performed using QuantStudio 6 Real-Time PCR System and SYBR Green PCR Master Mix (Applied Biosystems). Analysis of relative gene expression was carried out using the comparative CT method (ΔCT ...
-
bioRxiv - Developmental Biology 2021Quote: ... and human Oct 4 (For: 5’-CTTGCTGCAGAAGTGGGTGGAGGAA-3’/Rev: 5’-CTGCAGTGTGGGTTTCGGGCA-3’) PCRs were conducted using an ABI 7300 Real Time PCR System (Applied Biosystems). PCR cycling conditions were 95° C for 10 min. ...
-
bioRxiv - Cell Biology 2020Quote: ... was used to convert RNA to cDNA and 10 ng used in real-time PCR with Sybr Green PCR Master Mix II (Life Technologies) using primers from human and mouse GAPDH (see above).
-
bioRxiv - Cell Biology 2021Quote: ... KapaBiosystems) were used for the qRT-PCR reactions and these were performed with a StepOnePlus Real-Time PCR system (Applied Biosystems). Primers and probes were purchased from Oligomer and Roche Universal Probe Library ...
-
bioRxiv - Immunology 2021Quote: ... and PCR was performed on a QuantStudio 3 Real-Time PCR System machine using TaqMan Fast Advanced Master Mix (Applied Biosystems). Data were analyzed using the 2−ΔΔCt method against housekeeping gene Rpl19 and presented as relative expression compared to control ...
-
bioRxiv - Immunology 2021Quote: ... The resulting cDNA was used as template for quantitative PCR (qPCR) with the Power SYBR Green reagent on a 7500 Fast Real-Time PCR System (Applied Biosystems). Transcripts were normalized to Rps17 (40S ribosomal protein S17 ...
-
bioRxiv - Microbiology 2021Quote: ... TaqMan qPCR was performed in duplicate on the 7500 Real-Time PCR system using 2X PCR Universal Master Mix (Applied Biosystems) and primer/probe pairs specific for HSV-1 US4 ...
-
bioRxiv - Cell Biology 2021Quote: ... was performed on the Applied Biosystems QuantStudio 6 Flex Real-Time PCR System using Fast Universal PCR Master Mix and TaqMan Gene Expression assays (Applied Biosystems), listed in Table S1.
-
bioRxiv - Genetics 2020Quote: ... The PCR products and their dissociation curves were detected with a 7500 Fast real-time PCR system thermal cycler (Thermo-Fisher Scientific). The template cDNA was omitted in the qRT-PCR negative control ...
-
bioRxiv - Genomics 2021Quote: The quantitative PCR (qPCR) assay was performed on a QuantStudio™ 3 Real-Time PCR System (ThermoFisher Scientific Cat. no. A28567) in a 20 μl reaction mixture consisting of Luna® Universal qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 ng of digested/undigested DNA was then quantified by real time PCR using a 7500 FAST Applied Biosystems thermocycler with SYBR Green PCR Master Mix (Applied Biosystems) and 100 nM of primer in a 20 μl reaction ...
-
bioRxiv - Microbiology 2022Quote: ... 50 ng of cDNA was used to conduct qRT-PCR with SYBR green reaction mix on a Step One Real-Time PCR System (Applied Biosystems). 16S rRNA gene levels were used to normalize expression levels of KKP components in MPAO1 biofilms at different days ...
-
bioRxiv - Cell Biology 2022Quote: ... A total of 10 ng cDNA for each sample was used and all qRT-PCR reactions were performed on a ViaA 7 Real-Time PCR System (Life Technologies) using Brilliant II SYBR Green QPCR Master Mix (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... was used for qRT-PCR that was performed with the QuantStudio 3 Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific). The mRNA expression levels were normalized against the respective GAPDH expression in each sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... was used for qRT-PCR that was performed with the QuantStudio 3 Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific). The mRNA expression levels were normalized against the respective GAPDH expression in each sample ...
-
bioRxiv - Microbiology 2022Quote: ... and cDNA was analyzed by quantitative real-time polymerase chain reaction (qRT-PCR) analysis using SYBR green PCR master mix (cat#4309155, Thermofisher Scientific) with sequence specific primers ...
-
bioRxiv - Immunology 2022Quote: ... Normalization was performed using nidogen gene and quantitative PCR (qPCR) was performed on a StepOne Plus real-time PCR machine (Applied Biosystems), with the following settings (absolute quantification program) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Quantitative PCR (qPCR) was performed using a QuantStudio 3 Real-Time PCR System in conjunction with a SybrGreen System (ThermoFisher Scientific) for assessment of the expression of cell cycle- ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR analysis was performed with an Applied Biosystems 7500 Fast Real Time PCR System with TaqMan Universal PCR Master Mix and pre-designed TaqMan gene expression assays (Life Technologies). Relative expression levels were calculated using the comparative cycle threshold method referenced to ACTB.
-
bioRxiv - Pathology 2022Quote: ... qRT–PCR was performed using qPCRBIO SyGreen Mix (Protech) and the QuantStudio™ 6 Pro Real-Time PCR System (Applied Biosystems/Thermo Fisher Scientific Inc. ...
-
bioRxiv - Physiology 2022Quote: ... Resulting cDNA was then utilized for qPCR using Taqman Q-PCR probes in QuantStudio 5 Real-Time PCR System (ThermoFisher Scientific). Data was analyzed using Microsoft Excel and graphed in GraphPad PRISM v8.
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using QuantStudio Pro real-time PCR system with Power Track SYBR Green Master Mix reagents (Applied Biosystems).
-
bioRxiv - Plant Biology 2022Quote: ... and qPCR was performed in 10 μl reactions using qPCRBIO SyGreen Mix (PCR Biosystems) with a StepOnePlus Real-time PCR system (Applied Biosystems). For verifying transgene induction ...
-
bioRxiv - Cancer Biology 2023Quote: ... according to the manufacturer’s instructions with qRT-PCR performed using SYBR Green Master Mix (SparkJade) using a StepOnePlus™ real-time PCR intrument (ThermoFisher). Fat1 levels were measured using forward (5′ GGACCAGCATCGCAAGAGTC 3′ ...
-
bioRxiv - Neuroscience 2024Quote: ... TBP forward 5’-CCT GTT CAG AAC ACC AAT AGT TTA–3’ and reverse 5’–GTG GAT ACA ATA TTT TGG AGC TGT–3’ Real Time–PCR (qRT–PCR) was performed using PowerUp SybrGreen master mix (Applied Biosystems), using 0.25 μM each primer and 5–15 ng cDNA for each reaction in triplicate ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time PCR was conducted using ChamQ SYBR qPCR Master Mix (Vazyme, Q311) on an ABI StepOnePlus real-time PCR system (Applied Biosystems). Expression values were normalized using the ΔΔCt method with Gapdh as the internal control ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was obtained by reverse transcription using the M-MLV Reverse transcriptase and quantitative PCR was performed in technical triplicates on a Quant Studio 5 Real-Time PCR System (Applied Biosystems) using iTaq Univeral SYBR Green Supermix (Biorad ...
-
bioRxiv - Genomics 2024Quote: ... was performed using Power SybrGreen PCR master mix on a ViiA 7 real-time PCR system using standard settings (Applied Biosystems). Expression of genes was normalised to two housekeeping genes (Bactin ...
-
bioRxiv - Biochemistry 2024Quote: The expression of different target genes was validated by quantitative PCR (qPCR) using the 7500 Real-Time PCR Systems (Applied Biosystems). The reactions were performed with the Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR (qPCR) was performed using standard SYBR green reagents and protocols on a QuantStudio 7 Real-Time PCR system (Applied Biosystems). All reactions were performed in technical triplicates ...
-
bioRxiv - Cancer Biology 2024Quote: ... Analysis of gene expression was performed with the Applied Biosystems 7500 Real-Time PCR System using SYBR Green PCR Master Mix (Applied Biosystems) according to standard protocols ...
-
bioRxiv - Immunology 2022Quote: ... cDNAs obtained were diluted and quantitative PCR was performed using the PerfeCTa SYBR Green FastMix (Quantabio) on a QuantStudio 3 Real-Time PCR System machine (Applied Biosystems). Standard cycling was used (45 cycles of 95 ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR (qRT-PCR) was conducted using TaqMan Assay-on-Demand primer sets (Applied Biosystems by Thermo Fisher Scientific) or Power SYBR Green PCR Master Mix (Merck) ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR analysis was performed with 2×Realab Green PCR Fast mixture (Lablead, China) in a StepOnePlus real-time PCR instrument (Applied Biosystems). OsActin was used as an internal control gene ...
-
bioRxiv - Cancer Biology 2023Quote: ... The expression levels of selected genes were determined using qRT-PCR (QuantStudio 6, ThemoFisher Scientific) using the SYBR Green Real-time PCR master mix (Thermo Scientific). The sequence of the primers used for the gene expression analysis was given in an appendix.
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR reactions were performed in duplicates including non-template controls on a QuantStudio 3 Real-Time PCR system (Applied Biosystems). Expression levels of analyzed genes relative to a reference gene (ACTB or Actb ...
-
bioRxiv - Cell Biology 2022Quote: ... Real-time RT-PCR analysis was performed using SYBR Green Realtime PCR Master Mix (Toyobo) with the Applied Biosystems Step Two Real-Time PCR System (Applied Biosystems). GAPDH was used as a control ...
-
bioRxiv - Cancer Biology 2023Quote: ... TaqMan Universal PCR Master Mix or Power SYBR Green PCR Master Mix (Applied Biosciences) were used to amplify transcripts using QuantStudio3 Pro Real-Time PCR System (Applied Biosystems). Relative expression of target genes was measured comparing against housekeeping controls β-actin or Ef1a.
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative PCR was performed with triplicates in 96-well plate format on the QuantStudio 3 Real-Time PCR system (ThermoFisher Scientific). HORMAD1 ...
-
bioRxiv - Biochemistry 2023Quote: ... The abundance of mRNA was measured by quantitative real-time PCR analysis using the SYBR Green PCR Master mix (Applied Biosystems). PCR was carried out with 96-well plate using Applied Biosystems 7500 Real-Time PCR Systems ...
-
bioRxiv - Microbiology 2023Quote: Real-time PCR was performed by standard TaqMan Assay on either the QuantStudio 7 or Quantstudio 5 Real-Time PCR platform (Applied Biosystems). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA product was further diluted 1:4 in nuclease-free water and 2 μl were used in a 15 μl total reaction for qRT-PCR (7500 Fast Real-Time PCR instrument; Applied Biosystems), using SYBR green as nucleic acid stain (Roche 4913850001) ...
-
bioRxiv - Immunology 2023Quote: ... DNA products were used for real time qRT-PCR reaction using the TaqMan 2X Universal PCR Master Mix (Thermo Fisher Scientific) on an iQ5 RT-PCR detection system (BioRad ...