Labshake search
Citations for Macherey-Nagel GmbH :
2051 - 2100 of 2266 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and immediately transferred to a tube containing 400 µL of RA1 lysis buffer from the Nucleospin 96 RNA core kit (Macherey-Nagel) and ∼20 1-mm glass beads (BioSpec) ...
-
bioRxiv - Biophysics 2024Quote: ... using mouse genomic DNA as a template and primer pairs 5’CAAAGAGCTCCTCGTCCAGT3’ and 5’ ATGGACTCCAGGACCCAAGA3’ followed by a column purification using the NucleoSpinⓇ Gel and PCR Clean-up Kit (Macherey-Nagel). For the in vitro cleavage assay ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products for each single cell clone were combined and purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel). Afterward using a second round of PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the resulting fragment was purified using the NucleoSpin Gel and PCR Clean-up kit according to the manufacturer’s instructions (Macherey-Nagel, 740609.250). The purified CASP3 gene fragment was ligated into the linearized pEGFP-N3 vector using the quick ligationTM kit according to the manufacturer’s instructions (NEB ...
-
bioRxiv - Microbiology 2024Quote: The genomic ssDNA was isolated from the ion exchange-purified sample of the phage using a Virus DNA kit (Macherey-Nagel). For sequencing on the Oxford Nanopore platform ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from cells at the indicated time points post stimulation and/or infection using the NucleoSpin RNA extraction kit (Macherey-Nagel) as directed by manufacturer ...
-
bioRxiv - Microbiology 2024Quote: ... Single colonies were grown in 5 ml liquid LB medium at 37 °C overnight and the plasmid DNA was extracted using NucleoSpin® Plasmid preparation kit according to the manufacturer’s instructions (Macherey-Nagel). Positive clones were identified by restriction digestion and DNA sequencing ...
-
bioRxiv - Plant Biology 2024Quote: Leaf discs of the relevant transgenic and azygous lines were ground in dry ice and RNA extractions were performed following the nucleospin RNA/Protein kit (Macherey-Nagel). RNAseq was performed by Novogene ...
-
bioRxiv - Plant Biology 2024Quote: ... Positive colonies were inoculated into 5 ml of LB medium with kanamycin (50 μg.mL−1) for overnight cultures at 30°C in order to isolate cloned plasmids using the Nucleospin plasmid kit (Macherey-Nagel). Identities of the cloned sequences were confirmed by Sanger sequencing using pHREAC sequencing primers (Table S6) ...
-
bioRxiv - Physiology 2024Quote: ... They were linearized with the PacI restriction enzyme and purified with the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). Finally ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The fragments were separated by electrophoresis in 1% (w/v) agarose gel and PCR purification was performed with the NucleoSpin PCR purification kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: The embryos used for RT-qPCR were directly transferred to the RA1 buffer supplemented with 2-Mercaptoethanol provided with the NucleoSpin RNA kit (Macherey-Nagel) and stored at -80°C for further RNA extraction.
-
bioRxiv - Genomics 2024Quote: RNA from muscle and bone marrow samples collected in Brussels was extracted separately using the Nucleospin® RNA kit (Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR products were run on 1% agarose gel stained with 1X SYBR-Safe (Thermo) and extracted using the NucleoSpin Gel and PCR Cleanup Kit (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA expression plasmids were extracted and were purified from bacterial cells with NucleoBond® Extra Midi Plus kit (Macherey-Nagel, Germany) and they were stored at -20°C until their use for transient transfection into mammalian cells.
-
bioRxiv - Cell Biology 2024Quote: Total RNA from MCF7 cells was obtained with a Macherey-Nagel™ Total RNA Isolation kit (Macherey-Nagel, Germany, Cat # 740955.50) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... and the desired band was excised and purified using the NucleoSpin Gel and PCR Cleanup Kit (Macherey-Nagel, catalog no. 740609) following the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated from A375-C and A375-Cx43 untreated cell lines and under BRAF/MEKi (dabrafenib and trametinib) treatment (n=4, each condition) using the Kit RNA isolation: NucleoSpin RNA (Macherey-Nagel). Quality and integrity of each RNA sample was checked using a Bioanalyzer 2100 instrument (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: RNA from whole colon Swiss roll sections stored in Optimal cutting temperature (OCT) compound was isolated with the NucleoSpin RNAII Kit (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... DNA was extracted from fresh leaves using the NucleoSpin Plant II Mini kit for DNA from plants (Macherey-Nagel, Duren, Germany) and sequenced using the HiSeq 4000 sequencing system (Illumina Inc. ...
-
bioRxiv - Cell Biology 2024Quote: ... The cloned gRNA + pSpCas9(BB)-2A-Puro V2.0 constructs were then isolated from the bacterial culture using a plasmid isolation kit (Macherey-Nagel, #740588.50). Following isolation ...
-
bioRxiv - Immunology 2021Quote: ... Positive clones were identified by colony PCR and the plasmids were isolated using NucleoSpin® Plasmid EasyPure kit (Macherey-Nagel, Düren, Germany). The DNA sequence of the cloned devil CIITA transcript was verified by Sanger sequencing using Big Dye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems (ABI) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid DNA was purified from the remaining cultures using a NucleoSpin Plasmid (NoLid) high-pure plasmid mini prep kit (cat. no. 740499.50, Macherey-Nagel, Bethlehem, PA) according to vendor instructions and quantified using the Qubit dsDNA BR Assay (cat ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we removed the last segments of the caudal section and preserved it in 96% ethanol before DNA extraction using the NucleoSpin® 96 Tissue kit (Macherey-Nagel). It is worth noting that the ablation of the last segments of the caudal section of earthworms does not affect their survival due to their regeneration capacity (e.g ...
-
bioRxiv - Genomics 2021Quote: ... embryos were ground in Tri-Reagent and RNA was purified using affinity chromatography (Nucleospin RNA Clean up kit, Macherey-Nagel, Duren, Germany). Potential contaminating DNA was removed by digestion with rDNase then RNA was purified using Beckman Coulter’s solid-phase reversible immobilization (SPRI ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was successfully extracted from pelvic fin tissue of 238 individuals (85.6%) out of 278 collected in August 2015 (i.e. survivors and non-survivors) using NucleoSpin® RNA kit (Macherey-Nagel, Düren, Germany) and ensuring RNA quality using the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Microbiology 2021Quote: ... mitochondrial and nuclear genomes we extracted genomic DNA from Pb-GFP infected hepatocytes treated or not with infusion using a NuceolSpin Tissue kit (Macherey-Nagel, Germany) according to manufacturer’s manual ...
-
bioRxiv - Neuroscience 2020Quote: ... Gel extraction was performed to select for products between 200 – 1000 bp using the Nucleospin Gel and PCR Clean-up kit (Macherey-Nagel, 740609). Samples were eluted in 11 μL NF H2O ...
-
bioRxiv - Plant Biology 2021Quote: ... Labelling was performed by PCR using vector-specific DY-682-labelled primers followed by PCR purification with NucleoSpin® Gel and PCR Clean-up kit (MACHEREY-NAGEL). Gel shifts were visualized using a LiCor Odyssey imaging system at 700 nm.
-
bioRxiv - Cell Biology 2021Quote: ... Eluates were digested with proteinase K and RNAse A and DNA fragments were purified using a PCR purification kit (Macherey-Nagel, #740609).
-
bioRxiv - Microbiology 2020Quote: ... 200 μL of the permeabilized sample was then processed using the Machery-Nagel NucleoSpin Virus kit (Macherey-Nagel, Catalog # 740983.50 and 740983.250).
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from a cell pellet obtained from 2-ml aliquots of the microbial cultures using the tissue DNA extraction kit (Macherey-Nagel, Germany). The amoA genes of AOB and AOA was amplified with primers amoA-1F/amoA-2R (66 ...
-
bioRxiv - Microbiology 2020Quote: ... Clonal virus populations were characterized by isolating viral RNA from 150 µl aliquots of the cell culture supernatant with the NucleoSpin® RNA Virus kit (MACHEREY-NAGEL) followed by conventional RT-PCR and bidirectional Sanger sequence analysis.
-
bioRxiv - Zoology 2021Quote: ... standard DNA extraction was performed using the NucleoSpin™ Plant II DNA extraction kit (Macherey-Nagel GmbH and Co., Düren NRW, Germany). A reasonable number (usually 30–70 ...
-
bioRxiv - Microbiology 2022Quote: ... Viral genome equivalents (vge) were determined by qPCR of DNA isolated from encapsidated virions isolated with NucleoSpin Blood kit QuickPure (Macherey-Nagel; 740569.250).
-
bioRxiv - Plant Biology 2021Quote: ... total RNA was extracted from root tissues of DKC-9144 and PG-2475 at three time points (15, 25 and 35 DAS) with or without PBZ using Nucleospin RNA plant kit (Pal et al., 2017) (Macherey-Nagel, Germany). cDNA synthesis and qPCR was performed as described previously (Pal et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the band with the expected size excised and purified using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). The second PCR products were sent for Sanger sequencing to Eurofins Genomics and checked for quality ...
-
bioRxiv - Microbiology 2020Quote: ... Polymerase chain reaction (PCR) products and plasmid digestion derivatives were purified using NucleoSpin® Gel and PCR Clean-up kits (Macherey-Nagel). Plasmids were extracted from E ...
-
bioRxiv - Microbiology 2020Quote: ... lung left inferior lobe from hamsters were cut into pieces and lysed with RA1 lysis buffer provided with the NucleoSpin® RNA Plus kit (Macherey-nagel), RNA extraction was performed according the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: gDNA from 6 male and 5 female pupae (sexed by eye) was extracted using the NucleoSpin Tissue kit (Macherey-Nagel, Düren, Germany), pooled by sex and used as template for subsequent PCRs ...
-
bioRxiv - Genetics 2022Quote: RNA extraction was performed from frozen tissue in culture plates (P6 well plate, Falcon®) by using the NucleoSpin RNA kit (Macherey-Nagel). RNA concentration was measured with NanoDrop1000 spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: Standard methods were used to determine the TSS and volatile suspended solids concentration.25 The COD was measured using test kits (Macherey-Nagel, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Cleaved Histone-DNA complexes were isolated by centrifugation and DNA was extracted with a NucleoSpin PCR Clean-up kit (Macherey-Nagel, 740609).
-
bioRxiv - Zoology 2020Quote: Approximately 50-100 mg of tissue (from the second pereopod) was used for DNA extraction using the NucleoSpin® Tissue Kit (Macherey-Nagel) following the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: Viral biodistribution analysis - Genomic DNA (gDNA) was extracted from the brain region of interest with the NucleoSpin®Tissue Kit (Macherey-Nagel) extraction kit and 100 ng of gDNA was used as a qPCR template ...
-
bioRxiv - Microbiology 2020Quote: We extracted DNA from the biomass pellets stored at −20°C using a NucleoSpin® Microbial DNA Kit (Macherey-Nagel, Düren, Deutschland), according to the manufacturer’s protocol ...
-
bioRxiv - Zoology 2020Quote: ... urticae (one butterfly individual per nest) collected across 8 sites spread across the latitudinal gradient using the NucleoSpin® 96 Tissue kit (Macherey-Nagel) (Figure 1) ...
-
bioRxiv - Microbiology 2020Quote: ... to reach at least 200x colonies per guide-RNA and the library plasmid pool was purified using NucleoBond Xtra-Maxi Kit (Macherey-Nagel, #740414.50). Then ...
-
bioRxiv - Microbiology 2020Quote: Lung left inferior lobes from hamsters were cut into pieces and lysed using the RA1 lysis buffer provided with the NucleoSpin® RNA Plus kit (Macherey-Nagel). RNA extraction was then performed according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... DNA extraction was performed on (i) the frozen suspension and (ii) the collected CFU suspension with the NucleoSpin® 96 Food kit (Macherey-Nagel) following the supplier’s recommendations.