Labshake search
Citations for Bio-Rad :
1 - 50 of 3840 citations for DIRAS Family GTP Binding RAS Like 1 DIRAS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibody binding was visualized using chemiluminescence (BioRad) on a BioRad ChemiDocTM Imaging System.
-
bioRxiv - Microbiology 2023Quote: ... Binding of VHHs was detected using a mouse anti-HIS-tag antibody (Biorad, MCA1396, 1/2000) and an AF647 conjugated donkey anti mouse IgG antibody (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Antibody binding was detected by chemiluminescence(Clarity kit, Bio-Rad).
-
bioRxiv - Neuroscience 2022Quote: ... Antibody binding was detected by chemiluminescence (Clarity kit, Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... The primary antibody binding was processed for ECL detection (Bio-Rad) with appropriate HRP-conjugated secondary antibodies (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2021Quote: ... Antibody binding was visualised using Clarity Western ECL Substrate (Biorad, UK) and viewed under the Gel Doc imaging system (GeneSys software ...
-
bioRxiv - Biochemistry 2021Quote: ... Drl family ECRs were further purified using an UnoQ anion exchange column (Bio-Rad), loading in 20 mM HEPES pH 7.5 containing 70 mM NaCl and using an elution gradient of 70 mM-1 M NaCl ...
-
bioRxiv - Systems Biology 2020Quote: ... Unspecific antibody binding was blocked with PBS/10% AB-serum (Bio-Rad) for 5 min at 4°C prior to staining with CD19 or CD3 ...
-
bioRxiv - Cell Biology 2023Quote: ... Antibody binding was detected using an ECL chemiluminescence kit (Bio-Rad, 1705061). The following antibodies were used ...
-
bioRxiv - Microbiology 2021Quote: ... The antibody binding was imaged with Clarity Western ECL Substrate (Bio-Rad, CA, USA).
-
bioRxiv - Cell Biology 2024Quote: ... The antibody binding was assessed with a ChemiDoc Imaging System (Bio-Rad, Madrid, Spain) and the density of bands was measured using ImageJ software v.1.8.0_172 (NIH ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the binding of HRP-conjugated antibodies was visualized using Clarity Western ECL Substrate (Bio-Rad). For immunoblotting we used the following antibodies ...
-
bioRxiv - Neuroscience 2020Quote: ... Nonspecific binding was blocked for 1 hr at RT with 5% BLOTTO (Bio-Rad) in Tris-buffered saline with 0.1% Tween (TBST) ...
-
bioRxiv - Neuroscience 2019Quote: ... Nonspecific binding was blocked for 1 h at room temperature with 5% blotto (Biorad) in Tris-buffered saline with 0.1% Tween (TBST) ...
-
bioRxiv - Cell Biology 2022Quote: ... a DNA-binding fluorescent dye (BioRad, SsoAdvanced Universal SYBR Green Supermix ...
-
bioRxiv - Immunology 2020Quote: ... The binding was detected by an HRP-conjugated anti-human IgG (Fc) CH2 Domain antibody (Bio-Rad MCA647P) used at a 1:5,000 dilution at RT for 1 h and developed as described above.
-
bioRxiv - Neuroscience 2020Quote: ... Aspecific binding sites were blocked for 30 min using TBS + 1% casein (BioRad, Temse, Belgium). Western blot was performed using the following primary antibodies overnight (4°C) ...
-
bioRxiv - Molecular Biology 2020Quote: ... using a DNA-binding fluorescent dye (BioRad, SsoAdvanced Universal SYBR Green Supermix ...
-
bioRxiv - Pathology 2020Quote: ... Antibody binding was detected with electrochemiluminescence substrate (#12757P; CST) and chemiluminescence visualized with ChemiDoc™MP Gel Imaging System (BioRad).
-
bioRxiv - Neuroscience 2022Quote: ... Beads were then transferred to fresh low- protein binding tubes and antibody-protein complexes were eluted by incubating in 60 μL 1x Laemmli Sample Buffer (Biorad, cat ...
-
bioRxiv - Biochemistry 2022Quote: ... h-Ras did not contain a HisTag and was purified on a Q-Sepharose column (Bio-Rad) in 20 mM Tris (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: ... The binding to protein G magnetic beads (Biorad) was performed for 1 hour at 4 ºC (with previous washes with a RIPA buffer) ...
-
bioRxiv - Microbiology 2021Quote: ... the membranes were washed 3 times with 1 x TBS-T and antibody binding was detected in a BioRad Versa Doc System with the Quantity One software (BioRad, Germany) by chemiluminescence using the Clarity Western ECL Substrate (BioRad ...
-
bioRxiv - Biochemistry 2022Quote: Equilibrium target binding assays were performed using a double-membrane filter-binding setup with a slot blot vacuum filtration device (BioRad SF) containing an upper nitrocellulose membrane (to capture protein and protein/RNA complexes ...
-
bioRxiv - Biochemistry 2022Quote: ... A 1:1 Langmuir binding model was used to fit the data measured on a ProteOn™ XPR36 instrument (Bio-Rad Laboratories) using ProteOn™ Manager Software (Version 3.1.0.6 ...
-
bioRxiv - Neuroscience 2021Quote: ... secondary antibodies (1:10000; 1:50000 for anti-H3 antibody, BioRad) in 5% milk/PBST at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibodies (1:10000; 1:50000 for anti-Gapdh antibody, BioRad) in 5% milk/PBST at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... secondary antibodies (1:10000; 1:50000 for anti-H3 antibody, BioRad) in 0.1% Tween-20 in 1x PBS (PBS-T ...
-
bioRxiv - Microbiology 2023Quote: ... AOA and of nxrB from Nitrospira- like NOB were determined using a CFX96 qPCR cycler (Bio-Rad, USA). Primer pairs for quantification were comamoAF/ comamoAR for CMX amoA [11] ...
-
bioRxiv - Plant Biology 2020Quote: ... Protein binding was detected by using ECL substrate (BioRad) and visualised by ImageQuant4000 (GE Healthcare ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Antibody binding in immunoblot analyses was detected using horse radish peroxidase-conjugated secondary antibodies and visualized using enhanced chemiluminescent chemistry (BioRad Clarity™) and visualized via Bio-Rad Chemidoc ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibody binding was detected using chemiluminescence ECL Prime Western Blotting Substrate (Cytiva) and images were acquired on ChemiDoc Touch (Bio-Rad Laboratories). The acquired images were processed and quantified using Image Lab software (Bio-Rad laboratories ...
-
bioRxiv - Cancer Biology 2020Quote: Protein lysates (see “RAS activity assays”) were mixed with 4×Laemmli buffer (Cat.#161-0747; Bio-Rad Laboratories, Hercules, US) containing fresh 200 mM DL-Dithiothreitol (Cat.#3483-12-3 ...
-
bioRxiv - Microbiology 2021Quote: ... binding was visualized with an enhanced chemiluminescence substrate (Bio-Rad) using the Bio-Rad Gel Doc XR+ System and Image Lab software according to the manufacturer’s instructions (Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... coli antibodies (1:100, Bio-Rad Antibodies, 4329-4906), followed by DyLight 650-conjugated donkey anti-rabbit IgG antibodies (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... serially diluted rabbit serum (5-fold dilution starting with 1:80) were tested for binding to color-coded beads by Bio-plex (Biorad). The beads were coated with avi tagged C.1086 WT ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was collected as the periplasmic-like fraction (P) and solubilized by mixing with 4X Laemmli sample buffer (Bio-Rad). The pellet was resuspended with the same volume of the 1X M9+ medium and solubilized with 4X Laemmli sample buffer ...
-
bioRxiv - Physiology 2023Quote: ... and the pellet resuspended in 37.5µL of Na+-free intracellular-like medium (120mM KCl; 1mM KH2PO4; 20mM HEPES; pH 7.2) that had been cleared with Chelex 100 (Bio-Rad # 1422822) to remove trace Ca2+ ...
-
bioRxiv - Systems Biology 2020Quote: ... unspecific binding was blocked using PBS/10% AB-serum (Bio-Rad) for 30 min at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... The MFIs were referenced to antibody binding capacity (ABC) using anti- rat quantum beads Quantum™ Simply Cellular® (QSC) microspheres (Bio-Rad, Cat# FCSC815A, RRID:AB_10061915) for quantification of BsAb bound on T cell.
-
bioRxiv - Cell Biology 2021Quote: ... coli antibody (1:100, Bio-Rad), anti-LAMP1 (1:200 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Unspecific binding was blocked using PBS/10% AB-serum (Bio-Rad, Germany). Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT ...
-
bioRxiv - Plant Biology 2023Quote: ... Proteins were quantified with the Coomassie dye binding method (BioRad, 500-0006) as described by the manufacturer.
-
bioRxiv - Immunology 2023Quote: ... Binding was detected with an anti-mouse IgG-HRP (STAR120P, Bio-Rad). ELISAs were developed using 1-Step-Ultra TMB ELISA substrate (Life Technologies) ...
-
bioRxiv - Immunology 2024Quote: ... ACPA IgG levels were quantified based on an in-house standard of pooled RA patient plasma using the Microplate manager software MPM-6 (Bio-Rad Laboratories, Inc.). Unspecific reactivity to the peptide backbone was assessed by applying CArgP2 ...
-
bioRxiv - Immunology 2021Quote: ... Binding was measured using a Bio-Plex 200 instrument (Bio-Rad Laboratories, Inc.). HIV-1 human hyperimmune immunoglobulin (HIVIG ...
-
bioRxiv - Pathology 2019Quote: ... anti-CD68 antibody (1:200, MCA1957; BioRAD) and anti-collagen I antibody (1:200 ...
-
bioRxiv - Cell Biology 2020Quote: ... HRP-conjugated secondary antibodies (1:10,000; BioRad); ECL detection system (VWR ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (Cd68 (1:500, BioRad MCA1957), Iba1 (1:400 ...