Labshake search
Citations for Bio-Rad :
201 - 250 of 7689 citations for 6 oxo 1 phenyl 1 4 5 6 tetrahydro pyridazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Cancer Biology 2021Quote: ... Acid-treated fiber spreads were incubated with 1/1000 rat anti-BrdU mAb (Bio-Rad) for 1.5 hour to detect CldU ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Microbiology 2020Quote: ... Cell lysates were mixed with Bradford reagent (1:5; Bio-Rad) and absorbance was measured at 595 nm ...
-
bioRxiv - Molecular Biology 2024Quote: ... were used at 1:5000 in 5% Blotting-Grade Blocker (BioRad).
-
bioRxiv - Genetics 2019Quote: ... at 4° C with 100 V for 1 hour in 1 x Tris/Glycine Buffer (Bio-Rad, Cat#1610734) and 20% methanol (Fisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... The reaction was quenched with 2µl of 10mM EDTA and desalted with Microbio-spin 6 column (BioRad) to remove unincorporated nucleotides ...
-
bioRxiv - Biochemistry 2020Quote: ... The thiol-reduced protein was exchanged into anaerobic 0.5x TNG buffer using Microbiospin 6 columns (Bio-Rad). The protein concentration was determined by the Bradford assay (ThermoFisher scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... Unconjugated dye was removed by passing the protein through Micro Bio-spin P-6 column (Bio-rad) equilibrated in GF150 buffer (25 mM HEPES (pH 7.4) ...
-
bioRxiv - Microbiology 2020Quote: ... separated on 6% acrylamide 8M urea gels and transferred to Zeta Probe GT membranes (Bio-Rad laboratories) by electroblotting ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein lysates (50µg) were loaded on a 6% SDS-PAGE gel and transferred to nitrocellulose membrane (BioRad) using a wet electroblotting system (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA preparation involves coating 10 μl of .6 μm Gold microcarriers (1652262 Bio-Rad, Hercules, CA) with 1μg of purified DNA by gently vortexing DNA ...
-
bioRxiv - Immunology 2021Quote: ... IL-18 and IL-6 concentrations were measured using the Bio-Plex Pro Human Cytokine Assay (BioRad).
-
bioRxiv - Plant Biology 2022Quote: ... cumana KAI2d1-6 genes from parental lines and segregants using iProof High-Fidelity DNA Polymerase (BioRad #172530). The PCR products were then sequenced via MiSeq ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction mixture was desalted by twice passing through Micro Bio-spin 6 chromatography columns (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction mixture was desalted by twice passing through Micro Bio-spin 6 chromatography columns (Bio-Rad).
-
bioRxiv - Plant Biology 2023Quote: ... the treated protein was cleaned up using a Micro Bio-SpinTM P-6 Gel Column (BIO-RAD), and then they were further subjected to 5 mM sodium (meta ...
-
bioRxiv - Molecular Biology 2023Quote: ... then resuspended in 600 µl TNM100 buffer and transferred into Micro Bio-Spin 6 columns (Bio-Rad). The elution from IgG Sepharose beads was achieved by incubation with 30 µl homemade GST-tagged TEV protease for two hours on a shaking table at 16 °C.
-
bioRxiv - Developmental Biology 2023Quote: ... and monitoring of mCherry expression after 6 and 22 h (ZOE fluorescent cell imager, Bio-Rad, 1450031).
-
bioRxiv - Neuroscience 2021Quote: ... with primers listed in Table 4-1 on a CFX96 system (BioRad). Thermocycler conditions were 95°C for 3 min followed by 40 cycles of 95°C for 10 sec and 55°C for 30 sec ...
-
bioRxiv - Cancer Biology 2022Quote: ... was added to a 1:4 mixture of Laemmli Sample Buffer (BioRad) and 2- Mercaptoethanol (BioRad ...
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Genomics 2024Quote: ... samples were embedded in a thin polyacrylamide film by inverting them onto a GelSlick-coated microscope slide with a droplet of 4% acrylamide solution (4% v/v 20:1 acrylamide:bis-acrylamide [BioRad, 1610144] with 0.15% v/v TEMED [Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... the membrane was washed four times in TBS-T for 5 min each before incubation for 1 h with secondary antibody (1:2,000 dilution of BioRad affinity purified goat α-rabbit IgG conjugated to alkaline phosphatase ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were loaded onto polyacrylamide native gels (5% polyacrylamide 29:1 [BioRad], 1× TBE, 0.3% APS, and 0.06% Temed) and protein/DNA complexes were resolved by electrophoresis at 60 V for 2 h at 24 °C in 1X TBE ...
-
bioRxiv - Biochemistry 2023Quote: ... expression media samples were diluted with 2X reducing SDS sample buffer at 1:1 ratio and the mixture was loaded on a 10-well 4–20% SDS-PAGE gradient gel (BioRad). Image J software was used to quantify the signal compared to the negative control (mock transfected culture) ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR analysis was performed using 1 μl diluted cDNA with biological (2-3) and technical replicates (2-3) using SsoAdvanced SYBR reagent (Bio-Rad) and Bio-Rad qPCR platform ...
-
bioRxiv - Molecular Biology 2022Quote: ... and incubated for 1 h with 5% blotting grade blocker (Bio-Rad). Primary antibodies were incubated overnight at 4℃ and secondary HRP-conjugated antibodies were incubated for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... After 1 h blocking (5% non-fat milk, Bio-Rad 170–6404) at room temperature (RT) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 30 μL egg extract was applied to and eluted from a Micro Bio-Spin 6 column (Bio-Rad) equilibrated in ELB150 ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.032 % (w/v) SM was applied to a centrifugal device (Micro Bio-Spin 6, Bio-Rad, Hercules) to exchange the buffer to a MS buffer containing 200 mM ammonium acetate (pH 7.4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was purified by loading quenched samples onto Micro Bio-spin Columns with Bio-Gel P-6 (BioRad), followed by ethanol precipitation ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by 6 washes in 100 µL of PBST in Bio-Spin columns (catalog number 7326204, Bio-Rad). The bound immunocomplexes were eluted via 0.1 M glycine ...
-
bioRxiv - Biochemistry 2021Quote: KirBac3.1 protein was buffer-exchanged to 200 mM ammonium acetate (pH=8.0) with 0.5% C8E4 (2×CMC) using a Biospin-6 column (BioRad). The protein sample was loaded into a gold coated needle prepared in-house and analysed on a modified Q-Exactive mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: ... solutions containing purified CytbX were buffer-exchanged into 0.2 M ammonium acetate (pH 8.0) containing 2x CMC of Lauryldimethylamine oxide (LDAO) using Biospin 6 columns (Biorad). 2-3 µL of 5 µM protein solution was introduced directly into Q-Exactive UHMR mass spectrometer (ThermoFisher ...