Labshake search
Citations for Bio-Rad :
51 - 100 of 7689 citations for 6 oxo 1 phenyl 1 4 5 6 tetrahydro pyridazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The deamination reaction was then carried out by incubating in a thermal cycler for four cycles of 5 minutes at 70°C followed by 1 hour at 60°C and then desalted with Micro Bio-spin 6 chromatography columns (Bio-Rad). RNA was desulphonated by adding an equal volume of 1 M Tris (pH 9.0 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... antigen retrieval was performed in trypsin (pH 7.8) or 10 mM sodium citrate buffer (pH 6) and then incubated with F4/80 antibody (1:50; MCA497, Bio-Rad) or UCP-1 antibody (1:500 ...
-
bioRxiv - Microbiology 2019Quote: ... The libraries were quantified and checked for amplifiable adapters using the Library Quantification DNA standards 1-6 (Kappa Biosystems, Wilmington, USA) with the SsoFast EvaGreen qPCR supermix (Bio-Rad) using 10 μL EvaGreen master mix ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously described 58 and a custom Bio-Rad 6-plex based on the Human Inflammation Panel 1 (BioRad, Cat# 171AL001M). For both assays ...
-
bioRxiv - Biochemistry 2022Quote: ... and purified by vertical gel electrophoresis on a 6% (60:1 Acrylamide/Bisacrylamide) native gel column using a 491 Prep Cell (Bio-rad) run at 10W and 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were boiled at 95 °C for 10 mins with 6×SDS sample buffer before loading onto 4–20% Tris-glycine gels (BioRad). Resolved proteins were transferred to nitrocellulose membranes using the Trans-Blot® Turbo system (BioRad ...
-
bioRxiv - Systems Biology 2021Quote: ... and 6 μl for slow growing mutants with lower OD600) on Stain-Free gels (4-20%, CAT # 4568096, Bio-Rad, Tris/Glycine SDS Buffer (CAT # 161-0732 ...
-
bioRxiv - Microbiology 2020Quote: ... pH6.9 using a micro biospin 6 column (Bio-Rad). The FOS sample was diluted to ∼500 µM with 0.5 M ammonium acetate ...
-
bioRxiv - Microbiology 2020Quote: ... and Bio-Plex Manager software (v.6, Bio-Rad). The data were expressed as median fluorescence intensity (MFI ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown at 30°C for 3-6 days and images captured using a Chemidoc XRS+ imager (BioRad, Hercules, CA). All images were evenly adjusted in Photoshop (Adobe Systems Incorporated ...
-
bioRxiv - Molecular Biology 2023Quote: ... Table 1) was performed at 4°C overnight at a 1:1000 dilution in 5% nonfat dry milk (Bio-Rad No. 1706404). Incubation of HRP conjugated secondary antibody (different species ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Pathology 2023Quote: ... Heparin Sepharose 6 Fast Flow beads (1 ml) (Healthcare Life Sciences) were loaded into disposable Bio-Spin® chromatography columns (Bio-Rad) and packed with 2 ml of equilibration buffer (0.15 M NaCl in 25 mM HEPES ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Molecular Biology 2020Quote: ... IB analysis was performed after 6-7.5% SDS-PAGE or 4-20% Mini-PROTEAN TGX Precast Protein Gels (BioRad, Hercules, CA), with overnight incubation with a 1:1000 dilution of primary antibody and followed by a 1:5000 dilution of horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2019Quote: ... 4 µl of the diluted DNA sample was added to 6 µl of a mixture containing SYBR Green Supermix (Bio-Rad) and gene-specific primers (0·4 µM total ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... using 10 mM CAPS buffer (3-[cyclohexylamino]-1-propanesulfonic acid [pH 11]) in a Mini Trans-Blot Electrophoretic Transfer Cell tank (Bio-Rad) according to protocol provided by the manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: Protein bands intensities were quantified with Image Lab 6 (BioRad). Equal rectangles were drawn around the total protein gel lane and the band of interest ...
-
bioRxiv - Biochemistry 2019Quote: ... BioSpin 6 desalting columns were purchased from BioRad (Hercules, CA). Diethylamine NONOate (DEA NONOate) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6 μL of Sybr Green Super Mix 2X (Bio-Rad), 2,6 μl MQ H2O.
-
bioRxiv - Molecular Biology 2020Quote: ... resolving gels between 6% and 15% acrylamide/bis-acrylamide (BioRad) were used ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD, Hercules, CA, USA) for 30’ at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Unreacted linker was separated with Bio-Spin 6 columns (BioRad), that were previously equilibrated in PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were desalted using Biospin 6 columns (BioRad, CA), equilibrated with 50 mM triethylammonium bicarbonate and 0.02%(w/v ...
-
bioRxiv - Biochemistry 2022Quote: ... then desalted with Micro Bio-Spin 6 columns (Bio-Rad). To 22.5 μL of the resulting solutions was added KCl (final concentration 100 mM ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were incubated shaking for 1 hour at RT with 4% blocking solution (5% milk powder (BioRad) in TBS-T) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Additional pre-absorption controls were performed in which the anti-IL-6 antibody was incubated overnight at 4 °C with a 10 fold molar excess of recombinant chicken IL-6 (1.67 μM; Bio-Rad Laboratories, Inc.) before immunolabeling fixed sections of chick ocular tissues ...
-
bioRxiv - Neuroscience 2019Quote: ... 5uL of the sample was loaded into 4-6% polyacrylamide gel along with Precision Plus Protein™ Dual Color Standard (#1610374S, Bio-Rad) and was run at 120 V ...
-
bioRxiv - Genomics 2023Quote: ... The nuclei were isolated from cell homogenate by centrifugation and counted on an automated cell counter (TC20 BioRad, range 4-6 um). Transposition of 100k (weeks 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by heat-inactivation at 75°C for 5 min and desalting using Micro Bio-Spin P-6 columns (Bio-Rad, 7326221). Dephosphorylated guide RNAs were then radiolabeled using T4 Polynucleotide Kinase (0.33 U/µL ...
-
bioRxiv - Immunology 2021Quote: ... IL-6, TNF-α, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, IL-1RA, G-CSF and Eotaxin; Bio-Rad Laboratories Inc.) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... was run with a 1% agarose TBE gel over 24 hours (Initial switch 1 sec, final switch 25 sec, 6 volt/cm, 120° included angle, Chef III, Bio-Rad, Hercules, CA, USA) with Midrange PFG and Lambda PFG markers (N0342S ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were incubated with 6× Laemmle Sample Buffer (Bio-Rad) with 10% β-mercaptoethanol and boiled for 5 min at 100°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Following desalting with Micro Bio-spin 6 chromatography columns (Bio-Rad) twice ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 7.0 by passing through a MicroBioSpin-6 column (Bio-Rad), diluted 100-fold with the same buffer ...
-
bioRxiv - Physiology 2020Quote: ... followed by RNA purification with Micro Bio-spin 6 columns (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... and then run through Bio-Spin 6 columns (Bio-Rad #7326002) twice ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein band intensities were quantified via Image Lab 6 (Bio-Rad) as previously described in Stephani and Picchianti et al. ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Excess compounds were removed by Bio-Gel P-6 columns (Biorad) according to the manufacturer’s protocol ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... by using gel filtration with P-6 Bio-Spin columns (BioRad). The resulting protein concentration was estimated to be ∼1-2 µM before native MS analysis.
-
bioRxiv - Molecular Biology 2022Quote: ... Following clean up with Micro Bio-Spin 6 columns (Bio-Rad), the 3’-end-labeled RNA was incubated with RNase A (Thermo Scientific(tm) ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were separated on 6-10 % SDS-polyacrylamide gels or 4-20 % Mini-PROTEAN TGX precast gradient gels (Bio-Rad, CA, USA) together with Precision Plus Protein Dual Color Standards (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...