Labshake search
Citations for Bio-Rad :
751 - 800 of 6179 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The purified RNA was separate on a 1.2% agarose-formaldehyde denaturing gel and was then transferred to a nylon membrane (Hybond-N+, Cytvia) in 10X SSC buffer using a model 785 vacuum blotter (Bio-Rad). RNA was cross-linked to the membrane using an ultraviolet (UV ...
-
bioRxiv - Cell Biology 2019Quote: ... All the RT-qPCRs were carried out in the GoTaq real-time PCR detection systems by a CFX96 instrument (Bio-rad, Hercules, CA, USA). The resulting data were analyzed by the Bio-Rad CFX Manager 3.1 software (Bio-rad).
-
bioRxiv - Bioengineering 2020Quote: ... CTGGTTGTCAGGGGAGTGTT), CD206 (FP: CAAGGAAGGTTGGCATTTGT, RP: CCAGGCATTGAAAGTGGAGT), and β-actin (FP: GCCTTCCTTCTTGGGTATGG, RP: CAGCTCAGTAACAGTCCGCC) by RT-PCR using iTaq SYBR Supermix (Bio-Rad, Cat# 1725125) on a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Pathology 2021Quote: ... The reverse transcription- quantitative PCR (RT-qPCR) was performed to analyze the gene expression profile using SYBR® Green Supermixes (Bio-Rad, CA, USA) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... Complementary DNA was synthesized using the reverse transcription kit (PrimeScript RT reagent Kit) and quantitative (q)PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA). The housekeeping gene GAPDH was used for reference ...
-
bioRxiv - Neuroscience 2021Quote: ... and AMPKβ mRNA was measured by RT-qPCR employing TaqMan probes using the CFX-96 real-time PCR system (Bio-Rad, Hercules, CA, USA). The RT-qPCR TaqMan assay was carried out with the BrightGen HER2 RT-qDx assay kit (Syantra ...
-
bioRxiv - Plant Biology 2022Quote: Real-time quantitative RT-PCR (qPCR) was performed using the Rotor Gene 6000 with the iTaqTM Universal SYBR® Green Supermix (BIORAD, catalog 172-5151) and specific primers for the following genes ...
-
bioRxiv - Developmental Biology 2023Quote: ... jag1b and shha in single gill arches was assessed by real time reverse transcription PCR (RT-qPCR) using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, Missisauga, ON, Canada). Expression of reference gene elongation factor 1a (ef1a ...
-
bioRxiv - Microbiology 2023Quote: ... The extracted samples were analyzed for the presence of ASFV DNA by qPCR or CSFV RNA by RT-qPCR using the CFX Opus Real- Time PCR System (Bio-Rad, Hercules, CA, USA), essentially as described [27 ...
-
bioRxiv - Microbiology 2020Quote: ... one-step RT-qPCR was performed using the 4X Reliance One-Step Multiplex RT-qPCR Supermix (BioRad), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Following primers were designed by Bio-Rad; CCNE1 (qHsaCID0015131) ...
-
bioRxiv - Neuroscience 2023Quote: ... Divergent primers and SYBR green (Bio-Rad) were used for quantitative PCR (qPCR ...
-
bioRxiv - Bioengineering 2023Quote: ... All primers were purchased from Bio-Rad laboratories ...
-
bioRxiv - Developmental Biology 2023Quote: ... The reaction was set up in a DNA Thermocycler (Bio-Rad) and the conditions for PCR were ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was generated from RNA at a concentration of 400ng with iScript RT Supermix for RT-qPCR (BioRad). Expression levels were calculated relative to the average expression of 3 housekeeping genes via the ΔΔCt method.
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was generated by reverse transcription of the total RNA samples with iScriptRT Advanced cDNA Synthesis Kit for RT-PCR (Bio-Rad, Hercules, CA; #170–8891;). qRT-PCR was performed in triplicates using the iTaqTM Universal SYBR® Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: Commercially available TaqMan assays (Table S2) for droplet digital PCR were prepared using the One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad, Hercules, CA, USA; 1864022). Each 20-μL reaction mix consisted of 10 μL ddPCR Supermix for probes (no dUTP ...
-
bioRxiv - Microbiology 2022Quote: ... was used to perform Q-RT-PCR with the standard protocol recommended by the manufacturer and a C1000 Touch Thermocycler CFX96 Real-Time System (Bio-Rad La-boratories, Hercules, CA), with the following cycles ...
-
bioRxiv - Physiology 2022Quote: mRNA expression was analyzed by quantitative RT–PCR as previously described (49) using cDNA synthesis kits and SYBR green mix from Bio-Rad (Cat# 1708897 and 1725121) performed with the StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was generated after DNase treatment and used for quantitative real-time PCR (RT-qPCR) by use of the MyiQ Single-Colour Real-Time Detection System (Bio-Rad laboratories, Hercules, CA, USA) for quantification with Sybr Green and melting curve analysis ...
-
bioRxiv - Neuroscience 2023Quote: mRNA expression was analyzed by quantitative RT–PCR as previously described using cDNA synthesis kits and SYBR green mix from Bio-Rad (Cat# 1708897 and 1725121) performed with the StepOne Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RT-qPCR (SYBR green Bio-Rad), as indicated above.
-
bioRxiv - Plant Biology 2023Quote: ... We performed RT-qPCR by Bio-Rad CFX96 Real-Time System ...
-
bioRxiv - Plant Biology 2024Quote: ... and a CFX384 RT System (Bio-Rad) thermal cycler ...
-
bioRxiv - Plant Biology 2023Quote: ... and a CFX384 RT System (Bio-Rad) thermal cycler ...
-
bioRxiv - Microbiology 2019Quote: ... and primers and probes as previously described [21] in a CFX 96™ real-time PCR thermocycler and detection system (BIO-Rad, Marnes-la-Coquette, France). To estimate M ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... iScript RT supermix for RT-qPCR and iQ™ SYBR® Green Supermix for qPCR was from Bio-Rad Laboratories (Hercules ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA (1 μg) was used to generate cDNA using the Biorad iscript RT supermix RT-qPCR kit (Biorad) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... One-step RT-qPCR was performed using an iTaq Universal SYBR Green One-Step RT-qPCR Kit (BIO-RAD). The reaction was performed in a total volume of 20 μL by mixing 10 μL iTaq universal SYBR Green reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA (1 μg) was used to generate cDNA using the Biorad iscript RT supermix RT-qPCR kit (Biorad) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... DDOST primers can be purchased from Bio-Rad (DDOST 558C #10031279 ...
-
bioRxiv - Cancer Biology 2022Quote: ... primers and 2xSYBR master mix (Bio-Rad, 1725121) were analyzed with the cycling conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... primers (100nM) and IQ SYBR Green Supermix (BIORAD). Data was analyzed using the ∆∆C(t) ...
-
bioRxiv - Plant Biology 2019Quote: ... Gene-specific primers and iQSYBER Green Supermix (BioRad) were used on a C1000 Thermal Cycler (BioRad) ...
-
bioRxiv - Microbiology 2021Quote: ... All primers and probes were ordered from BioRad. 5 μL of cDNA was used for each reaction regardless of concentration ...
-
bioRxiv - Immunology 2020Quote: ... primers and SsoFast Sybr Green Master Mix (BioRad) and analyzed on a BioMark HD system (Fluidigm) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human GAD1 PrimePCR primers were purchased from BioRad and the sequence for human GAPDH primers are as follows ...
-
bioRxiv - Microbiology 2024Quote: ... We used the following PrimePCR primers from BioRad: interleukin-1β (IL-1β) ...
-
bioRxiv - Physiology 2022Quote: The relative abundance of target gene mRNA in the total RNA extracts was estimated by quantitative reverse transcription (RT) real-time PCR (BioRad model CFX Connect, Hercules, CA, USA). Real-time PCR reactions (qPCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... mRNA expression levels of target genes were analyzed by quantitative reverse transcription PCR (RT-qPCR) using the iTaq™ Universal SYBR® Green Supermix on a CFX384™ Real-Time System (both BioRad, Hercules, CA, USA) including melting curve analysis for quality assessment ...
-
bioRxiv - Neuroscience 2021Quote: ... Supernatant was set aside for protein quantification by Lowry assay (Biorad, 5000112) and the remainder was stored at -80°C until use for downstream assays.
-
bioRxiv - Microbiology 2022Quote: ... Reaction were set up using iTaq Universal SYBR® Gren Supermix (Biorad). Quantitative RT-PCR was performed with the QuantStudio™ 3 Real-Time PCR System (ThermoFisher) ...
-
bioRxiv - Bioengineering 2023Quote: ... which was determined by DC Protein Assay Set (Bio-Rad, Hercules, CA), was then used for data normalization.
-
bioRxiv - Plant Biology 2019Quote: ... and gene specific primers (primer sequences are listed in Table S4) and performed with the CFX96 qPCR Detection System (Bio-Rad). Statistical analysis of qRT-PCR data was carried out with REST2009.
-
bioRxiv - Microbiology 2021Quote: ... ICP1’s genome was amplified with primers Zac68/69 and PLE replication with primers Zac14/15 using iQ SYBR Green Supermix (Bio-Rad) and the CFX Connect Real-Time PCR Detection system (Bio-Rad) ...
-
bioRxiv - Bioengineering 2021Quote: ... 2.5 ng double-stranded DNA was added to a reaction mix containing target-specific primers/probe mixes (900 nM primer/250 nM probe per FAM and HEX fluorophore; Bio-Rad, 10042958 Unique Assay ID ...
-
bioRxiv - Microbiology 2022Quote: HCV RNA copies were determined by Taqman RT-qPCR using a Quanta BioSciences qScript XLT One-Step RT-qPCR kit according to the manufacture’s instruction (Bio-Rad). GLT1_probe was used to detect for GLT1 RNA ...
-
bioRxiv - Cell Biology 2019Quote: ... GEM-RT was performed using a Thermocycler (BioRad; 55 °C for 2 hours ...