Labshake search
Citations for Bio-Rad :
701 - 750 of 6542 citations for ssc mir 376c RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... RT-qPCR was performed in a qPCR machine (CFX Connect™ Real-Time PCR Detection System, Bio-Rad, Hercules, CA, USA) using SYBR Green Realtime PCR Master Mix (Toyobo ...
-
bioRxiv - Immunology 2020Quote: Whole muscle bulk gene expression was measured by RT-qPCR on a CFX96 Real-Time PCR Detection System (Bio-Rad, 1855195) in 20 μL reactions of iTaq™ Universal SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... cDNA was diluted in water in a 1:10 ratio and 1µl was used for RT-PCR was performed with an iCycler (Biorad, www.bio-rad.com/) using a Green MasterMix (Jena Bioscience ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-Time polymerase chain reaction (RT-PCR) was performed on the CFX 384 Touch™ Real-Time detection system (Bio-Rad Laboratories ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative real-time RT-PCR (qPCR) was performed using the Bio-Rad CFX384 thermal cycler and the iTaq Universal SYBR Green Supermix (Bio-Rad). All samples were processed in triplicate and analyzed as described previously (Livak and Schmittgen ...
-
bioRxiv - Microbiology 2020Quote: ... The concentration of total 16S rRNA gene copies per sample was also estimated using qPCR with the CFX96 RT-PCR machine (Bio-Rad). The concentration of the components in the qPCR mix used in this study were as follows ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed in duplicate for each gene using the CFX Connect™ Real-Time PCR Detection System (Bio-rad) and SYBRGreen PCR Master Mix (Eurogenetec) ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was subject to RT-qPCR for genes of interest in duplicate using a CFX96 real-time PCR system (Bio-Rad) at 95 °C for 3 min ...
-
bioRxiv - Neuroscience 2022Quote: ... The resulting cDNA was diluted 1:50 in water and subjected to RT-qPCR using the CFX384 Touch Real-Time PCR Detection System (BIO-RAD) and the ORA-qPCR Green ROX L 2X Mix (HighQu ...
-
bioRxiv - Microbiology 2022Quote: ... The RT-qPCR was performed with 2x RealStar Green Fast Mixture (Genstar) on Multicolor Real-Time PCR Detection System (Bio-Rad). Reaction parameters for thermal cycling were 95°C for 2 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using KOD SYBR qPCR Mix (TOYOBO) on a CFX Connect Real-Time PCR System (Bio-Rad Laboratories). Gene expression was assessed using the differences in normalized Ct (cycle threshold ...
-
bioRxiv - Plant Biology 2023Quote: RT-qPCR was performed in 96-well plates using the CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA, USA). Six biological replicates were used from each treatment and each qPCR run used three technical replicates of each sample (i.e. ...
-
bioRxiv - Developmental Biology 2023Quote: ... was generated by co-encapsulating the suspension with barcoded beads in in the 10X microfluidic chip and RT-PCR was performed in a C1000 Touch Thermal Cycler (Bio-Rad) with one of two programs ...
-
bioRxiv - Cell Biology 2023Quote: ... Changes in mRNA levels of the target genes were determined by relative RT-qPCR with a CFX96TM Real‒Time PCR Detection System (Bio-Rad) using iQ TM SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Physiology 2023Quote: ... Custom primers were designed to meet several criteria using NCBI Primer Blast followed by running of the complementary DNA (cDNA) synthesis product made using RT-PCR (iScript kit, Cat no. 1708890, Biorad, USA) on an electrophoresis gel ...
-
bioRxiv - Plant Biology 2020Quote: ... and 0.4 μM final concentrations of the gene-specific PCR primers on a CFX Connect Real-Time System thermal cycler (Biorad, Hercules, California). The qPCR conditions were 95°C for 3’ ...
-
bioRxiv - Plant Biology 2019Quote: ... see Table S1 for primer sequences) and was performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad, Watford, UK) with 40 cycles of 95°C-10s ...
-
bioRxiv - Developmental Biology 2020Quote: ... Arl4c or β-actin transcripts were quantified by real-time PCR using gene-specific primers and iTaq Universal SYBR Green Supermix (Bio-Rad). ΔCt (ß-actin Ct – Arl4c-Ct ...
-
bioRxiv - Physiology 2021Quote: ... were used for real-time PCR with gene-specific primers (Supplemental Table 1) and Tbp as a house keeping gene on a CFX96™ Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... and primers (indicated as followed) were used to quantify mRNA expression levels by realtime PCR using iQ™ SYBR® Green Supermix (BioRad) and CFX96 Touch Real-time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... and amplified using 2×TSINGKE master qPCR mix (Tsingke, Beijing, China) using specific primers designed for quantitative analysis in CFX96 Real-Time PCR Detection System (Bio-Rad, USA). Amplification was conducted for cycles of 95℃ for 10 s ...
-
bioRxiv - Immunology 2024Quote: ... RT-qPCR was conducted using HiScript II One Step qRT-PCR SYBR Green Kit (Q221-01, Vazyme) with gene-specific primer pairs on a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories). The thermal cycling protocol was as follow ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Immunology 2023Quote: Gene mRNA expression was determined by using primers in Table S1 with a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories) following reverse transcription with SuperScript Reverse Transcriptase (18064022 ...
-
bioRxiv - Plant Biology 2024Quote: ... or THUNDERBIRD® Next SYBR™ qPCR Mix (TOYOBO) with 250 nM primers using CFX Opus 384 Real-Time PCR System (BIORAD) in a volume of 10 μL ...
-
bioRxiv - Physiology 2024Quote: ... were used for real-time PCR with gene-specific primers (Supplementary Table 4) and Tbp as a housekeeping gene on a CFX96™ Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... and 200 nM of respective primers on a Mic qPCR Cycler (Bio Molecular Systems) or CFX Opus Real-Time PCR System (Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2024Quote: ... reactions were set up using 5–10 ng of cDNA as a template and gene-specific primers (200 nM) in a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). All reactions produced single amplicons ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA quality and recovery were checked by RT-qPCR (CFX96-RT-qPCR, Bio-Rad) according to manufacturer’s protocol (MiScript Primer assays and II RT kit for cDNA synthesis and MiScript SYBR Green PCR Kit for RT-qPCR ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time RT-PCR using FAST SYBR Green I technology was performed on an CFX96 Touch Real-Time Detection System (Biorad, Feldkirchen, Germany) using standard cycling conditions (15 min 95°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Cd206 (forward CAAGGAAGGTTGGCATTTGT, reverse CCAGGCATTGAAAGTGGAGT), and beta-actin (Actb) (forward GCCTTCCTTCTTGGGTATGG, reverse CAGCTCAGTAACAGTCCGCC) by RT-PCR using SYBR Supermix (Bio-Rad Laboratories) on a CFX Real-Time PCR Detection System (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2021Quote: ... RT-PCR experiments were performed on cDNA samples in presence of SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA, 1725271) with specific primers at 100 nM using the ABI Prism 7500 Sequence Detection System (ThermoFisher) ...
-
bioRxiv - Immunology 2019Quote: ... IFN or inflammatory cytokine mRNA expression levels were measured using quantitative RT-PCR on a CFX96 real-time system (BioRad, Hercules, CA); the two-temperature cycle of 95 °C for 15 s and 60 °C for 1 min (repeated for 40 cycles ...
-
Characterization of GRK5 as a novel regulator of rhabdomyosarcoma tumor cell growth and self-renewalbioRxiv - Cancer Biology 2019Quote: ... RT-PCR reactions were then run with iTaq Universal SYBR Green mix on a CFX Connect Real Time System (BioRad, Hercules, CA). RT-PCR primers used are listed below:
-
bioRxiv - Cancer Biology 2019Quote: ... One μg of total RNA was used to perform reverse transcriptase–polymerase chain reaction (RT-PCR) using iScript supermix (Biorad, Hercules, CA). The sequence of PCR primers used are ...
-
bioRxiv - Neuroscience 2020Quote: ... levels were quantified by real time polymerase chain reaction (RT-PCR) using SYBR® Green DNA intercalating dye and master mix (Bio-Rad) and the ABI 7900HT PCR machine ...
-
bioRxiv - Neuroscience 2021Quote: ... Selected genes were validated with reverse transcription and real-time PCR (RT-qPCR) with SYBR Premix on Bio-Rad CFX 96 (Bio-Rad Inc.), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... For analysis of isolated RNA semi-quantitative reverse transcription–polymerase chain reaction (RT) PCR was performed with the iScript™ cDNA Synthesis Kit (BIORAD, Germany) according to the manufacturer’s instructions using 500ng of isolated RNA ...
-
bioRxiv - Biochemistry 2020Quote: ... Real time polymerase chain reaction (RT-PCR) was performed with the CFX96 or CFX384 Touch(tm) Real-Time detection system (Bio-Rad Laboratories), using a SensiMix(tm ...
-
bioRxiv - Plant Biology 2020Quote: ... Q-PCR was performed on a Bio-Rad IQ5 real-time PCR detection system by using iTaq Universal SYBR Green One-Step RT-qPCR kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... First-strand cDNA was synthesized from 1 μg of total RNA using iScript Reverse Transcription Supermix for RT-PCR (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative mRNA expression was determined by real-time RT-PCR using iTaq Universal SYBR Green Supermix (Bio-Rad, catalog number 172-5121). rlp19 served as a housekeeping gene ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-Time quantitative Polymerase Chain Reaction (RT-qPCR) was performed using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories) using 3 ng of cDNA per reaction and Sensifast SYBR No-ROX mix (Bioline Corporation ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed on the cDNA in the CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, United States) using Bullseye EvaGreen Master Mix (MIDSCI ...
-
bioRxiv - Immunology 2019Quote: ... One μg of total RNA was used to perform reverse transcriptase–polymerase chain reaction (RT-PCR) using iScript supermix (Biorad, Hercules, CA). The sequence of PCR primers used are ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed for the expression of the exosome production-related genes listed in Appendix Table 1 by RT-PCR on a CFX Connect Real-Time System (Bio-Rad Laboratories).
-
bioRxiv - Genetics 2022Quote: ... The variations in mRNA levels of the target genes were established by relative RT-qPCR with a CFX96TM Real-Time PCR Detection System and the iQ™ SYBR Green Supermix (Bio-Rad) for the detection of single PCR product accumulation ...
-
bioRxiv - Neuroscience 2024Quote: The expression of mRNAs was quantified by real-time RT-qPCR on a CFX ConnectTM Real-Time PCR System (Bio-Rad Laboratories) in the presence of SsoAdvanced universal SYBR Green Mix (Bio-Rad Laboratories) ...
-
bioRxiv - Molecular Biology 2023Quote: ... where absolute quantification was done by the QX200 Droplet Digital PCR System in combination with the 1-Step RT-ddPCR Advanced Kit for Probes (BioRad, Hercules, USA). The detection limit was calculated to be 1000 copies per reaction ...
-
bioRxiv - Bioengineering 2023Quote: ... First-strand cDNA was synthesized from 1 μg of total RNA using iScript Reverse Transcription Supermix for RT-PCR (Bio-Rad Laboratories) according to the manufacturer’s instructions ...