Labshake search
Citations for Bio-Rad :
601 - 650 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: The PCR runs were performed in a Bio-Rad C1000 touch thermal cycler (Bio-Rad, Hercules, CA, USA) with the following cycling conditions ...
-
bioRxiv - Microbiology 2024Quote: ... 1x Supermix for Probes (Bio-Rad, Hercules, CA, USA), 250 nM of the probe ...
-
bioRxiv - Microbiology 2024Quote: ... blaOXA-48) and the intI1 gene by PCR methods 20-23 (Supplementary tables S1 and S2) in a Thermocycler (BIO-RAD T100™) using specific primer sets (Supplementary table S2) ...
-
bioRxiv - Microbiology 2024Quote: ... and tetracycline (30 µg) (Bio-Rad, France). Fresh 0.5 McFarland suspensions were prepared and plated on Mueller-Hinton agar (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... The gels’ stain-free dye was activated by a 5-min UV exposure and protein was transferred to Immun-Blot low-fluorescence PVDF membrane (Bio-Rad #162-0264) using Hoefer TE77X ...
-
bioRxiv - Molecular Biology 2024Quote: ... SDS-PAGE was performed using Mini-PROTEAN TGX Stain-Free Precast 4%–20% gels (Bio-Rad #456-8096). The gels’ stain-free dye was activated by a 5-min UV exposure and protein was transferred to Immun-Blot low-fluorescence PVDF membrane (Bio-Rad #162-0264 ...
-
bioRxiv - Microbiology 2024Quote: ... qPCR was performed on a CFX96 Real-Time PCR System (BioRad). Analysis of melting curves confirmed amplification specificity ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized 1 min in a TeSeE PRECESS 24 (Bio-Rad) using 0.5 mm glass beads (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... was applied to visualize immunoreactive bands in ChemiDoc XRS+ Imaging System (Bio-Rad). Blots were washed with TBS-T ...
-
bioRxiv - Cell Biology 2024Quote: ... and 12.5 μl of bis-acrylamide (cat no. 161-0142; Bio-Rad) in 250 μl of PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 18.8 μl of 40% acrylamide solution (cat no. 161-0140; Bio-Rad, Hercules, CA), and 12.5 μl of bis-acrylamide (cat no ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were run on a 12%TGX (Biorad) gels with and without boiling at 100°C for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Blots were further washed three times before chemiluminescence detection (SQ201, Yamei Biotech) using the ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... transferred onto a PVDF membrane (Bio-Rad), and probed with primary antibodies anti-HA (1:1,000) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were run on 4-20% TGX Precast Polyacrylamide Gels (Bio-Rad) or hand-cast single percentage polyacrylamide gels ...
-
bioRxiv - Microbiology 2024Quote: ... The amplification cycles were performed using a C1000 Touch Thermal cycler (Biorad). The results of qRT-PCR were normalised using the housekeeping gene ý-actin ...
-
bioRxiv - Microbiology 2024Quote: ... The iQ SYBR Green Supermix (Bio-Rad Laboratories, USA) and PCR primer pairs were used for PCR amplification ...
-
bioRxiv - Molecular Biology 2024Quote: ... The proteins were then transfer to a PVDF membrane using Trans-Blot Turbo Transfer system (Bio-Rad), blocked in 3% milk PBST and incubated overnight at 4°C with primary antibodies ...
-
bioRxiv - Microbiology 2024Quote: ... 1−10 ng of sample DNA was used for qPCR using a MiniOpticon qPCR detection system (Bio-Rad Laboratories, Hercules, USA). The iQ SYBR Green Supermix (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA quality was evaluated using the Experion RNA StdSens kit (Biorad Laboratories INC, USA), total RNA concentrations were measured with NanoDrop® and DNA contamination concentrations were measured with the Qubit®dsDNA BR Assay Kit ...
-
bioRxiv - Microbiology 2024Quote: ... Bio-Rad MyiQ was used to quantify the DNA concentration of the library using the Kapa iCycler qPCR kit (Bio-Rad Laboratories, Hercules, CA, USA). Sequencing was performed on the Illumina NextSeq 500 Platform (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... total RNA was extracted using the Aurum Total RNA Mini Kit (Bio-Rad), treated with DNase I (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... software in 0.2 ml 96-well PCR plates (dot scientific inc.) sealed with transparent Microseal B Adhesive Sealer (Bio-Rad). Data were analyzed using the comparative Ct (2-ΔΔCt ...
-
bioRxiv - Microbiology 2024Quote: ... using an electrotransfer apparatus (Bio-Rad). The electroblot transfer sandwich was assembled as follows (bottom to top) ...
-
bioRxiv - Microbiology 2024Quote: ... Data analysis was done on Bio-Plex ManagerTM 6.1.1 (Bio-Rad). Standard curves were generated with a 5-PL (5-parameter logistic ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was generated with iScript (Bio-Rad), and qPCR was performed by using iTaq Universal Probes Supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... run at 100 V and transferred to nitrocellulose membranes (# 1704158, Bio-Rad). Blots were blocked in 5 % milk diluted in tris buffered saline plus 0.1 % Tween 20 (TBS-T ...
-
bioRxiv - Molecular Biology 2024Quote: ... Droplet formation and PCR conditions were performed following the manufacturers’ instructions using ddPCR™ 96-well plate (Bio-Rad). QX200 Droplet Reader Bio-Rad was used to read the plates ...
-
bioRxiv - Molecular Biology 2024Quote: ... hY3 Rv: GAAGCAGTGGGAGTGGAGAA) and QX200 ddPCR EvaGreen Supermix (Bio-Rad-1864033) to a final volume of 23 μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... and ddPCR Supermix for Probes (Bio-Rad - 1863026) to a final volume of 23 μl ...
-
bioRxiv - Immunology 2024Quote: ... The CFX Real-Time System (BioRad) was used to scan the plate from 40–95 °C at a rate of 0.25 °C/min ...
-
bioRxiv - Microbiology 2024Quote: ... combined with anti-mouse-HRP secondary (Bio-Rad, #1706516, 1:5,000 dilution) antibodies ...
-
bioRxiv - Microbiology 2024Quote: ... SigA proteins were detected using anti-SigA85 (1:10,000 dilution) combined with anti-rabbit-HRP secondary (Bio-Rad, #1706515, 1:5,000 dilution) antibodies ...
-
bioRxiv - Immunology 2024Quote: ... were resolved by SDS-PAGE using 4-20% Mini-PROTEAN® TGX Stain-Free Precast™ Gels gels and transferred onto Trans-Blot® Turbo™ membranes (Bio-Rad). Membranes were blocked with 5% non-fat milk in TBS-T for 1 hour at room temperature and probed with primary antibodies against (Influenza A virus NS1 ...
-
bioRxiv - Immunology 2024Quote: ... and probes (SsoAdvanced Universal Probes Supermix, Bio-Rad Laboratories). The ViiA 7 Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Cartridges were covered with DG8TM droplet generator gaskets (Bio-Rad) and then placed into the droplet generator (QX200TM ...
-
bioRxiv - Cell Biology 2024Quote: ... and then placed into the droplet generator (QX200TM, Bio-Rad). After droplet generation ...
-
bioRxiv - Cell Biology 2024Quote: ... qPCR was performed by CFX ConnectTM system (Bio-Rad) using SYBR Green (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... using SYBR Green (Bio-Rad). At least three technical and three biological replicates were performed for each gene if not otherwise notated ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR was then performed to obtain corresponding cDNA using iScript Select cDNA Synthesis Kit (Bio-Rad). qPCR was performed by CFX ConnectTM system (Bio-Rad ...
-
bioRxiv - Developmental Biology 2024Quote: ... using CFX96TM Real-Time PCR Detection System (Bio-Rad). Transcript levels were normalized against Rplp0 expression ...
-
bioRxiv - Developmental Biology 2024Quote: ... proteins were transferred to PVDF membranes on Mini Trans-Blot® Cell (Bio-Rad) with chilled Transfer Buffer (5.82g Tris ...
-
bioRxiv - Cell Biology 2024Quote: ... The blots were visualized using the Clarity Western ECL kit from Biorad. The following antibodies were used ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein concentrations of the extracts were determined using a Bio-Rad protein assay kit (Biorad, 5000006). Proteins were diluted in Invitrogen 2X sample buffer (NuPAGE™ LDS Sample Buffer (4X ...
-
bioRxiv - Developmental Biology 2024Quote: ... and blotted onto PVDF membrane using the Trans-Blot Turbo Transfer System (Bio-Rad) for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... The goat anti-rabbit IgG-HRP conjugate (catalog number #17-6515) was sourced from Bio-Rad in Mississauga ...
-
bioRxiv - Cell Biology 2024Quote: ... The gel was then transferred to a nitrocellulose membrane with a pore size of 0.45 µm (Cat # 1620115, Bio-Rad). The nitrocellulose membrane was incubated in primary antibody diluted in blocking buffer (3% w/v milk in pH 7.6 Tris Buffered Saline with TWEEN® 20 (TBST)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... All mRNAs were transcribed using the SP6 mMessage mMachine kit (Fisher Sci #AM1340) and purified using Biorad Microbiospin columns (Biorad #7326250). Two guide RNAs targeting chordin and Three guide RNAs targeting tyrosinase were transcribed using T7 RNA polymerase (NEB #M0251s ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on 7.5% polyacrylamide gels or 4-20% gradient gels (Cat # 4561094 Bio-Rad, Hercules, USA). The gel was then transferred to a nitrocellulose membrane with a pore size of 0.45 µm (Cat # 1620115 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the goat anti-mouse IgG-HRP conjugate (catalog number #A-10668) was also acquired from Bio-Rad in Mississauga ...