Labshake search
Citations for Bio-Rad :
801 - 850 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... using QX200 ddPCR EvaGreen Supermix (Bio-Rad, 1864034) with eGFP primers (5’ TCAAGATCCGCCACAACATC and 5’ TTCTCGTTGGGGTCTTTGCT) ...
-
bioRxiv - Neuroscience 2024Quote: ... by boiling for 10 min at 98°C before loading onto a 4-20% gel (Bio-Rad, Hercules, CA), then transferred to PVDF 0.22 m membrane (Bio-Rad ...
-
bioRxiv - Physiology 2024Quote: ... and normalized to 2µg/µl containing Laemelli buffer (BioRad, Hercules, CA, USA, #1610747) for western blotting ...
-
bioRxiv - Developmental Biology 2024Quote: ... Proteins separated by SDS-PAGE were transferred to Immun-Blot PVDF membrane (Bio-Rad). Membranes were blocked with 0.3% skim milk in TTBS (50 mM Tris ...
-
bioRxiv - Physiology 2024Quote: ... An equal mass of protein was separated via polyacrylamide gel electrophoresis using Criterion TGX Stain-Free midi gels (Biorad 5678084 or 5678085) or NuPAGE Bis-Tris gels (ThermoFisher ...
-
bioRxiv - Physiology 2024Quote: ... (0.2 μm pore, Biorad), blocked in 5% NFDM in TBST ...
-
bioRxiv - Physiology 2024Quote: ... chemiluminescent substrate (Biorad Clarity; #1705060) was applied and membranes were imaged with a Chemidoc multipurpose imager ...
-
bioRxiv - Physiology 2024Quote: ... Proteins were resolved via SDS-PAGE using 4-15% Tris-glycine gels (Biorad) and subsequently transferred to PVDF membranes ...
-
bioRxiv - Plant Biology 2024Quote: ... and Experion™ RNA StdSens Chips (BIO-RAD, USA) were used to determine RNA integrity ...
-
bioRxiv - Plant Biology 2024Quote: ... lysed and solubilized in 1X SDS-sample buffer (Cat. #1610737; Bio-Rad), heated at 95 °C for 2 min and then centrifuged for 5 min to pellet cell debris ...
-
bioRxiv - Plant Biology 2024Quote: ... a 20 μL mixture of 14N- and 15N-labeled samples was loaded onto a Tris-glycine 4-20% polyacrylamide gel (Mini-PROTEAN TGX; Bio-Rad) and the proteins of the sample separated by electrophoresis at 60 V for 1 h ...
-
bioRxiv - Plant Biology 2024Quote: ... and imaging using a GelDoc XR+ System (BioRad).
-
bioRxiv - Plant Biology 2024Quote: ... Total protein concentration was determined by DC protein assay Kit (Bio-Rad) with bovine serum albumin standards ...
-
bioRxiv - Plant Biology 2024Quote: ... Clarity Western ECL substrate (Bio-Rad) was used for chemiluminescent protein detection ...
-
bioRxiv - Neuroscience 2024Quote: ... 30ug total protein was denatured under reducing conditions in sample loading buffer (Bio-Rad, Hercules, CA) by boiling for 10 min at 98°C before loading onto a 4-20% gel (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: ... Real-time PCR was performed using SYBR Green Supermix (Bio-Rad, Hercules, CA).
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 0.5% Tween (Bio-Rad, Hercules, CA), followed by overnight incubation with primary antibodies at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... then transferred to PVDF 0.22 m membrane (Bio-Rad, Hercules, CA). The membrane was blocked for 1 hour with 5% bovine serum albumin (BSA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and protein concentration was measured by Protein Assay Dye Reagent from Bio-Rad. Equal amounts of protein from each sample were mixed with SDS loading buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... iQ SYBR Green Supermix (Bio-Rad), and primers for PDHA1 and mtCYB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The ratio of optical density of the bands was measured by a gel image analysis system (Bio-Rad) and normalized to B-actin as a loading control.
-
bioRxiv - Cell Biology 2024Quote: ... Real-time PCR reactions were carried out using SYBR green Master Mix on a CFX96 Real Time system (BIO-RAD). Primer sequences are provided in the following table ...
-
bioRxiv - Neuroscience 2024Quote: ... The protein concentration was determined using a DC assay (Bio-Rad, Hercules, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Zoology 2024Quote: ... and 100 ng of RNA were used for cDNA synthesis with the iScriptTM gDNA Clear cDNA Synthesis Kit (Bio-Rad Laboratories, USA), resulting in a final concentration of 5 ng/μl for each sample.
-
bioRxiv - Biophysics 2024Quote: ... Detection was done using the Chemidoc XRS imaging system (Bio-Rad)..
-
bioRxiv - Zoology 2024Quote: ... and reactions were assembled with sSoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad Laboratories). Each virus was tested in triplicate for each sample using 3.75% of the cDNA reaction product ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were than electroblotted on Immuno PVDF membranes (Bio-Rad) for 7 min using Trans Blot Turbo System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2024Quote: ... and imaged on a ChemiDoc MP (Bio-Rad). Primary antibodies were as follows ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein were transferred onto nitrocellulose membranes (Bio-Rad), blocked in 2% milk in PBS with 0.05% Tween 20 (PBSTw ...
-
bioRxiv - Neuroscience 2024Quote: ... and transferred to 0.45-μm polyvinylidene difluoride membrane (Bio-Rad, 1704157). Blots were incubated with primary antibodies diluted in 5% nonfat milk in TBST (TRIS-buffered saline ...
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Neuroscience 2024Quote: ... Lysates were electrophoresed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis using a 4%–20% gradient polyacrylamide gel (Bio-Rad, 5678093) and transferred to 0.45-μm polyvinylidene difluoride membrane (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: ... for 7 min using Trans Blot Turbo System (Bio-Rad). Filters were washed three times and blocked for 1 hour in Tris-Tween buffered saline (TTBS ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... with CFX connect RT-PCR detection system (Bio-Rad).
-
bioRxiv - Physiology 2024Quote: ... gels were stained with Coomassie Coomassie Brilliant Blue R250 (Bio-Rad, Cat. No. 161-0436) and images were acquired using ChemiDoc system ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and fluorescence quantitative PCR instrument (Bio-rad Corporation, CFX).
-
bioRxiv - Physiology 2024Quote: ... The relative gene expression (ΔΔCq) was calculated using the CFX software Maestro™ (BioRad). All RT-qPCRs were performed in technical triplicates.
-
bioRxiv - Plant Biology 2024Quote: ... Six μL cDNA (diluted 1:5 with distilled water) was used per qRT-PCR reaction in a 15-μL reaction volume using SYBR Green (BIO-RAD, iTaq Universal SYBR Green Supermix) and a BIO-RAD CFX96 real time PCR instrument ...
-
bioRxiv - Physiology 2024Quote: ... Proteins were transferred to nitrocellulose membranes using Trans-Blot® Turbo™ Blotting System (Bio-Rad). Membranes were blocked with 5% skimmed milk (Scientific Laboratory Supplies ...
-
bioRxiv - Physiology 2024Quote: ... The qRT-PCR was performed using SybrGreen (iTAQ, Bio-Rad). Primer sequences are provided in Table 1 ...
-
bioRxiv - Physiology 2024Quote: ... using Criterion TGX Precast Protein Gels 4-20% (Bio-Rad) under reducing and denaturing conditions ...
-
bioRxiv - Physiology 2024Quote: ... Total RNA was extracted from tissues using AurumTM Total RNA Fatty and Fibrous Tissue Kit (Bio-Rad). Contaminating DNA was removed by treating the samples with DNase I (Bio-Rad) ...
-
bioRxiv - Physiology 2024Quote: ... and 250 ng (starvation assay and dsRNA injections) total RNA using the iScript™ Reverse Transcription Supermix for RT-qPCR (Bio-Rad, Mississauga, ON, Canada) following manufacturers protocol ...
-
bioRxiv - Physiology 2024Quote: ... Signals were revealed by chemiluminescence (Thermo Fischer) or the GeneGnome molecular chemiluminescence imager system (Syngene) and quantified by densitometry with Quantity one software (Bio-Rad).
-
bioRxiv - Physiology 2024Quote: ... proteins diluted in 2x or 4x Lämmli buffer (Biorad) (for 2x Lämmli ...
-
bioRxiv - Plant Biology 2024Quote: ... 26S (SUN) Universal probes for RT-qPcR and iTaq Mastermix (Biorad, Hercules,CA).Primers and probes used in this study are listed in Table 1 ...
-
bioRxiv - Physiology 2024Quote: ... The SYBRgreen intercalant was used for amplification detection with the Fast SYBRgreen master mix (Applied Biosystems and BioRad). Primers were designed using the Primer Express Software (Applied Biosystems) ...
-
bioRxiv - Physiology 2024Quote: ... One μg of total RNA was reverse-transcribed as per the manufacturer’s instructions (VWR and BioRad). The SYBRgreen intercalant was used for amplification detection with the Fast SYBRgreen master mix (Applied Biosystems and BioRad) ...
-
bioRxiv - Physiology 2024Quote: ... Quantification of target protein expression was performed with Image Lab Software (Biorad) and normalised to GAPDH or ß-Actin expression.
-
bioRxiv - Physiology 2024Quote: ... proteins were imaged using ChemiDoc Imaging Sysytem (Bio-Rad Laboratories, Hercules, CA). The levels of proteins were quantified using Image Lab software (Bio-Rad Laboratories ...