Labshake search
Citations for Bio-Rad :
1 - 50 of 10000+ citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... These samples were run on precast SDS-PAGE gels (Bio-Rad) and transferred to PVDF membranes ...
-
bioRxiv - Microbiology 2024Quote: Protein samples were incubated at 95°C for 10 minutes before being resolved on TGX Stain-free gels (Bio-Rad). The proteins were transferred onto 0.2 μm nitrocellulose membranes using Trans-Blot Turbo Transfer (Bio-Rad) ...
-
bioRxiv - Microbiology 2024Quote: ... Each reaction consisted of 5 μL iTaq Universal SYBR Green Supermix (Bio-Rad Inc.), 0.05 μL of 100 μM forward and reverse primers (27F ...
-
Hepatitis B Virus genomes associate with cellular sites of DNA damage by inducing replication stressbioRxiv - Microbiology 2024Quote: ... Supernatant was collected and the protein sample concentration was calculated using a bicinchoninic acid (BCA) assay (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... The Western Blots were developed with the use of Chemidoc XRS+ and analyzed using Image Lab software (BioRad).
-
bioRxiv - Microbiology 2024Quote: ... The blots were developed with Clarity Western ECL Substrate (BioRad) with the use of Chemidoc XRS+ and analyzed using Image Lab software (BioRad).
-
bioRxiv - Microbiology 2024Quote: ... Then 300 ng of plasmids were transformed into 100 μl of competent cells using the bacteria program on the MicroPulser Electroporator (Bio-Rad, CA, USA). After 1 h recovery culture at 37°C in 500 μl of LB ...
-
bioRxiv - Microbiology 2024Quote: ... The blots were developed with Clarity Western ECL Substrate (BioRad). After the first blotting ...
-
bioRxiv - Immunology 2024Quote: ... quantified using an automatic cell counter TC-20 (Bio-RAD, Hercules, US) and stored in the dark at 2–8 °C until use.
-
bioRxiv - Microbiology 2024Quote: ... with the use of Chemidoc XRS+ and analyzed using Image Lab software (BioRad).
-
bioRxiv - Microbiology 2024Quote: ... The free dsDNA and shifted protein-DNA complexes in the gels were then transferred to a nylon membrane and cross-linked using GS Gene Linker UV Chamber (Bio-Rad Laboratories, Hercules, CA). The nylon membrane was incubated with 20 μg/mL Proteinase K (Ambion ...
-
bioRxiv - Microbiology 2024Quote: ... and transferred onto PVDF membrane using a semidry transblot system (Bio-Rad). Next ...
-
bioRxiv - Microbiology 2024Quote: ... The separated proteins were transferred using semi-dry transfer (Biorad) onto nitrocellulose and blocked for 1 h at RT with 5 % fat-free dry milk in PBST (PBS supplemented with 0.1 % Tween-20) ...
-
bioRxiv - Microbiology 2024Quote: ... Secondary antibodies used for immunoblots were StarBright Blue 520 goat anti-mouse (IgG; 1:10,000; Bio-Rad) and Horseradish peroxidase conjugated-goat anti-mouse (IgG ...
-
bioRxiv - Microbiology 2024Quote: ... in 5% milk at room temperature and imaged using ChemiDoc MP Imaging System (Bio-Rad). Antibodies used for immunoblotting can be found below ...
-
bioRxiv - Microbiology 2024Quote: ... Proteins were then transferred to a nitrocellulose membrane (Cytiva) using the semi-dry Trans-Blot Turbo Transfer system (Bio-Rad). The membrane was blocked in 5% milk in TBS-T (tris-buffered saline ...
-
bioRxiv - Microbiology 2024Quote: ... The total protein concentration in the samples was measured using the DC Protein Assay (BioRad) with bovine serum albumin as standard ...
-
bioRxiv - Immunology 2024Quote: ... The gel was imaged under the Silver Stain setting on Image Lab 6 on a Gel Doc EZ Imager (Bio-Rad). ImageJ was used to quantify band intensities and determine peptide loading efficiencies.
-
bioRxiv - Immunology 2024Quote: ... filtered through Freeze ‘N Squeeze DNA Gel Extraction Spin Columns (Bio-Rad; #7326165) and purified via ethanol precipitation ...
-
bioRxiv - Immunology 2024Quote: cDNA was synthesized using the Bio-Rad Iscript buffer (Bio-Rad Lab. Hercules, CA) as per the manufacturer’s instruction ...
-
bioRxiv - Immunology 2024Quote: ... Data were acquired using Bio-Plex Manager Software version 6.1 (Bio-Rad).
-
bioRxiv - Immunology 2024Quote: ... qPCR was performed using Bio-Rad SYBR Green (Bio-Rad Lab. Hercules, CA) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was prepared by following manufacture’s instruction (iScript select cDNA synthesis kit, BioRad). The GNL primers (GTTTGGAGA CAATGATGGCGT/TCCCGTTCCAGCGAGAGTAAC ...
-
bioRxiv - Immunology 2024Quote: ... Droplet Generation Oil for Probes (Bio-rad Laboratories, #1864110), and pressurized air lines were connected to the Bubble-triggered device via PE/2 tubing (Scientific Commodities ...
-
bioRxiv - Immunology 2024Quote: ... The total protein concentrations were determined by the Bradford protein assay (Bio-Rad), and proteins were boiled at 95 °C for 5 min with SDS sample loading buffer (60 mM Tris-HCl ...
-
bioRxiv - Immunology 2024Quote: Protein samples were separated on SDS-PAGE and transferred to PVDF membrane (BioRad). The membrane was blocked in TBST buffer (25 mM Tris-HCl ...
-
bioRxiv - Immunology 2024Quote: ... and visualized by ChemiDoc (Bio-Rad) using the Image lab program.
-
bioRxiv - Immunology 2024Quote: ... The HRP signals were developed with Clarity ECL substrate (Bio-Rad) and visualized by ChemiDoc (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... These lysates were then used with the iTaq Universal SYBR Green One-Step Kit (BioRad) for RT-qPCR in the BioRad CFX96 ...
-
bioRxiv - Microbiology 2024Quote: ... Lysis was conducted utilizing the SingleShot Cell Lysis Kit (BioRad), with its defined protocol ...
-
bioRxiv - Microbiology 2024Quote: ... proteins were transferred to a nitrocellulose membrane (BioRad). Immunoblotting protocols were then followed according to company protocol for each antibody ...
-
bioRxiv - Microbiology 2024Quote: ... We used the following PrimePCR primers from BioRad: interleukin-1β (IL-1β) ...
-
bioRxiv - Microbiology 2024Quote: ... These concentrations were used to load equal sample of proteins into Any-kDTM Mini-PROTEAN® TGXTM Precast Protein Gels (BioRad) for SDS-PAGE ...
-
bioRxiv - Microbiology 2024Quote: ... Gels were imaged at ChemiDoc (Bio-Rad) using either SYBR Gold (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... Protein concentrations were measured using the Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, Hercules, CA, USA), and diluted to 0.7 mg/mL with Solution A ...
-
bioRxiv - Cell Biology 2024Quote: ... using the semidry method (Bio-Rad). Membranes were blocked for 1 hr at room temperature with 5% nonfat dried milk in Tris-buffered saline plus Tween 20 (TBST ...
-
bioRxiv - Cancer Biology 2024Quote: ... Proteins were separated using Any KD SDS-PAGE (Biorad) gel and transferred onto a PVDF membrane by the application of 250 mA for 90 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... The chemiluminescence signal was detected using Chemidoc MP imaging systems (Biorad).
-
bioRxiv - Cancer Biology 2024Quote: ... Serum hormones were quantified on a Luminex MAGPIX platform using the Bio-Plex Pro Mouse Diabetes 8-Plex and Adiponectin Assays (Bio-Rad, Hercules, CA) and the IGF-1 mouse Luminex Discovery Assay (R&D Systems ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20 μg of protein extracts were mixed with 4x Laemmli sample buffer with 2-mercaptoethanol (Biorad) and heated at 95°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by chemiluminescent detection with Clarity Western ECL Substrates (Bio-Rad, 1705060).
-
bioRxiv - Cancer Biology 2024Quote: ... or Clarity (BioRad) in an Azure c600 camera (Azure Biosystems) ...
-
bioRxiv - Cancer Biology 2024Quote: ... after integrating the peak areas of the Cu chromatograms of a mix of metalloprotein standards (GFS, 1511901, Bio-Rad Laboratories, Inc.) and normalized by the total area of the respective chromatogram at 280 nm.
-
bioRxiv - Cancer Biology 2024Quote: ... Chemiluminescence was performed using Western HRP Substrate and imaged using the Bio-Rad ChemiDoc MP Imaging System (Bio-Rad Laboratories) and Image Lab software.
-
bioRxiv - Cancer Biology 2024Quote: ... goat anti-mouse IgG(H+L)- or goat anti-rabbit IgG(H+L)-HRP conjugated (Bio-Rad, 1721019), followed by chemiluminescent detection with Clarity Western ECL Substrates (Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: ... Droplets were generated using the QX200 Droplet Digital PCR System per the manufacturer’s protocols using Droplet Generation Oil for Probes (BioRad #1863005) and DG8 Cartridges and Gaskets (BioRad #1864007) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and DG8 Cartridges and Gaskets (BioRad #1864007). PCR was performed with the following cycle ...
-
bioRxiv - Cancer Biology 2024Quote: ... and ddPCR Supermix for Probes (No dUTP) (Biorad #1863024). Droplets were generated using the QX200 Droplet Digital PCR System per the manufacturer’s protocols using Droplet Generation Oil for Probes (BioRad #1863005 ...
-
bioRxiv - Cancer Biology 2024Quote: ... custom ddPCR primer/probes were designed as described above and ordered from BioRad. Then ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription was performed on 1 μg of RNA using the iScript™ cDNA Synthesis Kit (Bio-Rad #1708891). Then ...