Labshake search
Citations for New England Biolabs :
401 - 450 of 3908 citations for Thymidine Kinase 1 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation of RNA fragments was achieved using T4 Polynucleotide Kinase (NEB) and Adenosine 5’-Triphosphate (ATP ...
-
bioRxiv - Microbiology 2023Quote: ... by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs) at 37°C for 1 h.
-
bioRxiv - Molecular Biology 2023Quote: ... dinucleotide primers were 5’-labeled using T4 polynucleotide kinase (New England Biolabs) and added at 20 µM without pre-annealing to the template ...
-
bioRxiv - Biophysics 2022Quote: ... and 10 units of T4-polynucleotide kinase (New England BioLabs, Ipswich, MA) in 70 mM Tris/HCl pH7.6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... nucleic acids extracted from SPARDA were phosphorylated by T4 polynucleotyide kinase (NEB) according to the manufacturer’s protocol and were separated by 18% PAGE ...
-
bioRxiv - Molecular Biology 2023Quote: ... and end repaired with T4 Polynucleotide Kinase (T4 PNK; NEB, catalog # M0201) at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads were treated with 10 μl of T4 Polynucleotide kinase (PNK; NEB) in 100 μl of 1X T4 PNK Reaction buffer containing 1 U/μl SUPERase•In™ RNase Inhibitor at 37°C for 30 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... The ATP and ADP makers were created using T4 polynucleotide kinase (NEB). T4 PNK mixed with 128 µM ATP supplemented with 10 nM [α-32 P]-ATP ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-end radiolabeled DNA was generated with T4 polynucleotide kinase (M0201L, NEB) and [γ-32P]ATP (NEG035C005MC ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated at 5’-termini by T4 Polynucleotide Kinase (M0201, New England Biolabs) and ligated using T4 DNA Ligase (M0202 ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA substrates were 5’ terminally labelled with T4 Polynucleotide Kinase (NEB, M0201S) and ATP-γ-32P (PerkinElmer ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant SYNJ2BP (0.5 µg) was dephosphorylated using 1 µl of calf intestinal alkaline phosphatase (CIP) (NEB) in 1x CutSmart Buffer in a total volume of 10 µl ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was incubated for 1 h with 50 µL anti-V5-tag mAb-Magnetic beads (#M167-11, MBL) blocked with 1 mg/mL BSA (#B9000S, New England Biolabs). Beads were washed seven times with lysis buffer ...
-
bioRxiv - Systems Biology 2022Quote: ... anti-SNAP (1:1000, rabbit, NEB, P9310S); anti-MRPS18B ...
-
bioRxiv - Molecular Biology 2021Quote: ... SET8 recombinant enzyme (New England Biolabs # M0428S) was incubated with recombinant active PARP1 (Trevigen # 4668-100-01 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3µl recombinant AsiSI endonuclease (10U/µL, NEB) was added to three biological replicates and incubated (2 h ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and recombinant shrimp alkaline phosphatase (rSAP, NEB) overnight and PCR purified (Qiagen QIAQuick PCR Purification Kit ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and recombinant shrimp alkaline phosphatase (all NEB) at 37°C overnight ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.2 mg/mL recombinant albumin (NEB B9200S), 1 μM RT primer ...
-
bioRxiv - Molecular Biology 2020Quote: Yeast total RNA was first treated with T4 Polynucleotide Kinase (PNK) (NEB M0201S) in order to remove possible phosphorylated 3’ends before polyA tailing ...
-
bioRxiv - Molecular Biology 2020Quote: ... Unprobed and probed RNAs were treated with T4 Polynucleotide Kinase (PNK) (NEB, M0201S) as described above before proceeding with ONT Direct cDNA sequencing.
-
bioRxiv - Genomics 2019Quote: ... the RNA was gel extracted and was dephosphorylated using polynucleotide kinase (NEB #M0201S). A Universal miRNA cloning linker (NEB # S1315S ...
-
bioRxiv - Microbiology 2019Quote: ... RNA fragments were dephosphorylated using T4 polynucleotide kinase (New England Biolabs, Ipswitch, MA), precipitated ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNAs were 5′-labeled with 32P-γ-ATP using T4 polynucleotide kinase (NEB) and purified on P-30 spin columns (Bio-Rad) ...
-
bioRxiv - Biophysics 2021Quote: ... pH 8.4 using cAMP-dependent protein kinase A (New England Biolabs, Frankfurt, Germany). The phosphorylated vimentin was mixed at the desired ratios of 1 ...
-
bioRxiv - Genomics 2022Quote: ... RNA was phosphorylated on the 5’ end using T4 polynucleotide kinase (NEB, M0201L) then ligated onto a 5’ adapter ...
-
bioRxiv - Cancer Biology 2022Quote: Oligos of the gRNAs were annealed with T4 polynucleotide kinase (New England Biolabs) by PCR ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5’ ends were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, M0201L). Each gene-specific pool of 51mer oligonucleotides was mixed with a 20mer ligation adapter (ACAGTCACTTCAACACTCAG ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was removed 3’phosphoryl groups using T4 Polynucleotide Kinase (New England Biolabs) in the buffer (70 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: DNA or RNA was labeled at 5′-termini with T4-Polynucleotide kinase (NEB) using ψ-P32-ATP as indicated in Figure 2 ...
-
bioRxiv - Microbiology 2022Quote: RNAs for direct cDNA sequencing were treated with T4 Polynucleotide Kinase (NEB, M0201) following the manufacturer’s non-radioactive phosphorylation protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... Oligo pairs were annealed and phosphorylated by T4 Polynucleotide kinase enzyme (NEB, M0201S), chloroform extracted ...
-
bioRxiv - Biochemistry 2019Quote: ... RNA primer end-labeling was accomplished using T4 polynucleotide kinase (T4 PNK, NEB) and 25 μCi of ATP ...
-
bioRxiv - Microbiology 2019Quote: ... Extracted crRNAs were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, MA, USA), radiolabeled with γ-[32P]-ATP (PerkinElmer ...
-
bioRxiv - Microbiology 2019Quote: ... An aliquot of the purified amplicons was phosphorylated using T4 Polynucleotide Kinase (NEB) using the manufacturer’s recommended reaction mixture and we extended the incubation ...
-
bioRxiv - Developmental Biology 2019Quote: ... Each oligo pair was annealed using T4 Polynucleotide Kinase (PNK) enzyme (NEB, M0201S) and then cloned into the sgRNA(MS2)_puro backbone (Addgene 73795 ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated with 10 U of phosphatase-free T4 polynucleotide kinase (New England BioLabs) for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... by incubating the DNA with T4 polynucleotide kinase (10 units; New England Biolabs) in the reaction medium provided by the supplier for 30 min at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... After end repair (T4 DNA polymerase, T4 DNA polynucleotide kinase, Klenow (all NEB) in the presence of dNTPs in ligation buffer (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... B and C oligonucleotides were phosphorylated with T4 polynucleotide kinase (NEB, Cat #M0201L) according to the manufacturer recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA 5′ ends were phosphorylated with T4 polynucleotide kinase (New England Biolabs). Adapters were ligated to the 5′ and 3′ ends of the RNA and first-strand cDNA synthesis was performed using M-MLV reverse transcriptase ...
-
bioRxiv - Microbiology 2022Quote: ... Linear products were phosphorylated with T4 Polynucleotide Kinase (New England Biolabs, MA, USA) for 1 hr at 37°C and circularized with T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Plant Biology 2022Quote: ... the linear PCR product was phosphorylated using T4 polynucleotide kinase (New England Biolabs) and ligated with T4 DNA Ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... The annealed oligos were phosphorylated using T4 polynucleotide kinase (PNK, New England Biolabs). The phosphorylated and annealed oligos were then diluted in Tris-EDTA (TE ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 10 units T4 Polynucleotide Kinase (PNK) enzyme (New England Biolabs, cat#M0201S) for 2 hours at 37°C in 1X T4 PNK buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.75 µl 0.1 M DTT and 0.3 U/µl T4 Polynucleotide kinase (NEB), and then incubated at 37°C 30 min ...
-
bioRxiv - Genetics 2023Quote: ... and treated with a mixture of USER enzyme and T4 polynucleotide kinase (NEB). DNA was circularized at a concentration of 5 ng/μL with T4 DNA ligase (NEB) ...
-
bioRxiv - Immunology 2023Quote: ... RNA fragments were then 3lll-dephosphorylated using T4 polynucleotide kinase (New England Biolabs) for 6 hours at 37°C in 2-(N-morpholino)ethanesulfonic acid (MES ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was phosphorylated for 1h at 37°C with T4 Polynucleotide kinase (NEB or made in-house by the Molecular Biology Service ...
-
bioRxiv - Genetics 2023Quote: ... The ICU11_sgRNA1_F/R oligonucleotides were phosphorylated using T4 polynucleotide kinase (New England Biolabs) and hybridized in a thermal cycler (Bio-Rad Laboratories T100) ...