Labshake search
Citations for New England Biolabs :
601 - 650 of 10000+ citations for Protein Digestion kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... forward (5’-AAGCCAAGTCTGCATGAGTA-3’) and reverse (5’-TAAATGTGCCACTGACTAAAT-3’) followed by a restriction enzyme digestion with Sau96I (New England Biolabs) at 37ºC for 2-3 hours ...
-
bioRxiv - Molecular Biology 2019Quote: ... Guide RNA sequence targeting human TLK1 exon 10 (TAACTGTTGTAAAGTGCCCG) were cloned into the plasmid pX330-CRISPR-Cas9-SV40prom-EGFP (Cong et al., 2013) after digestion with BbsI (NEB). Cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... the chain of multiplex tRNA-gRNA with three NsWOX9-spacers was inserted into an optimized vector with AtU6-tRNA-gRNAs-AtUbi10-Cas9-pRGEB31-bar backbone by digestion and ligation using Fok I (NEB) and BsaI enzymes (Xie ...
-
bioRxiv - Biochemistry 2021Quote: ... The insert is fused during cloning through an overlapping proline-encoding CCG codon introduced by reverse and forward primers at the 3’- and 5’-end of the sybodies and MBP respectively and released by digestion with the Type IIS restriction enzyme SapI (NEB). The second proline of the linker is encoded in the forward primer of the MBP (3’ of the overlapping CCG codon ...
-
bioRxiv - Genomics 2019Quote: ... the immunoprecipitated protein-bound sepharose beads was washed four times with PBS and suspended in the DNaseI digestion buffer containing DNaseI (6 Units of M0303S NEB). The samples were incubated for 10 minutes at room temperature and centrifuged at low speed to separate two fractions ...
-
bioRxiv - Genetics 2020Quote: ... The F1 progeny of the injected animals were selected for the roller phenotype and screened by PCR (forward primer 5’ TTGGAAGTGTTCGGTTACAAAA; reverse primer 5’ AAACTAAAATTGGCACGAAACG; IDT) and NcoI restriction digestion (New England Biolabs). Non-roller ...
-
bioRxiv - Biophysics 2021Quote: ... the corresponding set of specific primers (Table S1) and digestion of the template from the reaction mix with DpnI (New England Biolabs), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... the SV40 promoter was removed from the luciferase-enhancer plasmids by restriction digestion with BglII and HindIII-HF (both NEB). The Fgf5 promoter region - encompassing the 300 bp region containing most of transcription initiation events in PRO-Cap-Seq data at the 5’ UTR of the gene plus 100 bp of flanking nucleotides on each side - was amplified by PCR and inserted in place of the SV40 promoter by Gibson Assembly ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1× NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme [NEB]) and incubated at 37 °C for 3 hours with constant shaking ...
-
bioRxiv - Cell Biology 2020Quote: 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1x NEB 1 buffer, 1% triton X-100, and 100 U HpaII enzyme (NEB)) and incubated at 37°C for 3 hours with constant shaking ...
-
bioRxiv - Microbiology 2019Quote: ... The pBAMD1-4 plasmid was linearized by digestion with HindIII-HF and EcoRI-HF (New England Biolabs # R3104S and # R3101S) at 37 °C for 2 h in Cutsmart buffer ...
-
bioRxiv - Microbiology 2021Quote: ... cassette was inserted between the VP30 gene and the blasticidin resistance marker by restriction enzyme digestion of the vector with SpeI-HF and SalI-HF (NEB), and digestion of a pEF1a-IRES vector (www.takarabio.com ...
-
bioRxiv - Genetics 2020Quote: ... The ‘2A-Puro-WPRE’ sequence was then removed from the LCv2 plasmid via restriction digestion with PmeI (NEB, Cat# R0560S) and BamHI (NEB ...
-
bioRxiv - Genetics 2020Quote: ... followed by Sanger sequencing using shani F2 primer (oligonucleotide primer sequences are provided in Table S2) or by digestion of the amplified product with MnlI (NEB) or BstNI (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... The same procedure was used for double digestion with the PstI-MspI enzymes (New England Biolabs ®, Ipswich, Massachusetts, USA).
-
bioRxiv - Biophysics 2021Quote: ... The R525E-R527E mutant plasmid was generated using pET-24a-XccBphP as a template for mutagenesis using whole plasmid amplification followed by DpnI template digestion (New England Biolabs). This was achieved using Q5 High-Fidelity DNA Polymerase (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... Insertion of hACE2 into pLVX-IRES-puro was conducted by doubl e digestion of XhoI and XbaI (Fermantas) and ligation of T4 ligase (NEB) according to manufact urer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... to reduce base-pairing with both MMD-sg8 and MMD-sg10 and cloned into the lentiviral vector pLV-EF1a-IRES-blast by restriction digestion with EcoRI-HF (NEB) and BamHI-HF (NEB) ...
-
bioRxiv - Plant Biology 2022Quote: ... the UBQ10 promoter was removed from pUB-RFP-DEST through digestion with restriction endonucleases PspXI and PmeI (New England Biolabs) and the vector subsequently re-ligated using Klenow polymerase (DNA Polymerase I ...
-
bioRxiv - Microbiology 2022Quote: ... The relative abundance of oligomannose-type glycans was measured by digestion with Endoglycosidase H (per sample in 20 µl volume) (Endo H; New England Biolabs). A 6 µl aliquot of labelled glycans was combined with 1 µg endoH to a final volume of 20 µl ...
-
bioRxiv - Molecular Biology 2022Quote: Purified modified RNA and RNA without any chemical modification were digested with the Nucleoside digestion mix (M0649, New England Biolabs) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... zebrafish were genotyped by PCR amplification of the shank3b gene with subsequent digestion with T7 endonuclease I (M0302; New England BioLabs). Genotypes were verified on a 2% agarose gel ...
-
bioRxiv - Cell Biology 2022Quote: ... The full-length mCherry sequence was amplified by PCR and inserted into pTK93-Lifeact-mCherry vector where the Lifeact-mCherry sequence was removed by restriction digestion with BamHI and SalI (New England Biolabs). The primers were 5’-AATTGGATCCGCCACCATGGTGAGCAAGGGCGAG-3’ (forward ...
-
bioRxiv - Plant Biology 2022Quote: ... and the PCR product was cloned into the pENTR223 entry vector by SfiI digestion followed by sticky-end ligation performed by the T4 DNA ligase (New England BioLabs). To clone the 1098 bp promoter region and 5’-UTR of the PHOSPHOLIPID TRANSFERASE PROTEIN gene (PLTP ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using 55 fmol of purified cassette after BbsI-HF (for photoautotrophy screening with p1 plasmids) or BsaI-HF (for antibiotic screening with pM plasmids) digestion (New England Biolabs) of the corresponding plasmid ...
-
bioRxiv - Genetics 2023Quote: ... were then ligated to the digestion products in 50 µl reactions using 400 cohesive end units of T4 DNA ligase (NEB). Following ligation ...
-
bioRxiv - Neuroscience 2023Quote: ... (see the sequence map in Figure 1) was subjected to restriction digestion using two restriction enzymes: XbaI and AccI (New England Biolabs (NEB)) in the cutsmart buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total amount of 100 ng of small RNA or mRNA was digested with a Nucleoside Digestion Mix (New England BioLabs) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for protein expression having an N-terminal hexahistidine fused to a SUMO tag and a TEV cleavage site (His6-SUMO-TEV) were designed by restriction digestion of p1S vector (QB3 MacroLab) with Ssp1-HF(NEB) followed by Gibson assembly of the protein of interest ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... The guide seqences were purchased as DNA oligos and cloned into the PX458 Cs9 ad sgRNA expression vector by digestion with the BbsI restriction enzyme (NEB) and ligation using T4 Ligase (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... Genotypes for SNVs were determined by restriction digestion of its PCR products with suitable enzymes (New England Biolabs Inc, Ipswich) following manufacturers’ protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmid already containing MLANA and λN-ADAR2DD(-NLS) was opened by restriction digestion with the enzyme ClaI (NEB, #R0197). The six PCR products were then inserted into the ClaI-digested plasmid in a single reaction with NEBuilder (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... MNase digestion was performed in 100 µl of digestion buffer containing 1 mM CaCl and 40 U of Mnase (New England Biolabs) at 24°C for 15min while shaking ...
-
bioRxiv - Biochemistry 2022Quote: ... The purity and approximate size of the cloned fragment were assessed by agarose gel electrophoresis after endonuclease digestion simultaneously with BamHI and XbaI (New England Biolabs, in NEBuffer 3.1 at 37° for 1 hour using 1 U of enzyme per 1 μg DNA) ...
-
bioRxiv - Cell Biology 2023Quote: ... the synthesized S100A11 was removed from the pEX-A128 plasmid by restriction digestion with XhoI and SacII (New England Biolabs), then cloned into a pTK14-GFP plasmid9 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... A plasmid harboring Cas9 and an empty guide RNA transcription cassette was linearized by NotI/BsaI double digestion (New England Biolabs) and transformed into yeast together with a linear piece of DNA containing the guide RNA sequence flanked on either side by homology to the plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... the CMV PSAM4 GlyR WPRE BGH pA plasmid was subjected to an overnight restriction digestion reaction using BsaI-HF v2 (NEB). The restriction reaction products were run on a gel ...
-
bioRxiv - Biochemistry 2023Quote: ... the genes incorporating POIN-CAGEN with IRES2_EGFP or CAGEC-POIC with IRES2_mCherry were cloned into the 3rd generation lentiviral vector via restriction enzyme digestions using ClaI and MluI (New England Biolabs) followed by ligation using T4 DNA ligase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... The guide RNA target site was amplified from transfected cells and PCR products were analyzed by T7 Endonuclease I digestion (New England Biolabs) or Sanger sequencing followed by ICE analysis (Synthego ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli cells and streaked onto Luria-Burtani (LB) plates containing carbenicillin. All-by-all repressor constructs (Fig. 5c) were cloned by digestion with BsiWI-HF (NEB) and BbsI (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: Fresh omentum and omental HGSOC tumor metastasis biopsy samples were cut into small pieces and dissociated in digestion solution (1 mg/mL collagenase/Dispase [Sigma cat. no. 10269638001], 1 unit/mL DNase I [NEB, cat ...
-
bioRxiv - Genomics 2023Quote: ... followed by digestion to ribonucleotides by incubation for 2 h at 45 °C with 0.15 U of Nuclease P1 (NEB M0660S) in 10 mM ammonium acetate pH 5 ...
-
bioRxiv - Microbiology 2023Quote: ... Foreign glycoproteins were then cloned into this vector by either digestion with MluI and PacI or by seamless cloning using the HiFi NEBuilder (NEB) kit ...
-
bioRxiv - Molecular Biology 2023Quote: Expression cassettes were excised from the pDPL0 vector through Esp3I-digestion and ligated in tandem using T4 ligase (20U/µl, New England Biolabs) for assembly into the Esp3I-digested pLG0 vector backbone ...
-
bioRxiv - Biochemistry 2023Quote: ... In-gel digestion was performed with trypsin (Trypsin Gold, Mass Spectrometry Grade, Promega, Madison, WI; Trypsin-ultraTM, MS grade NEB) with a final trypsin concentration of 20 ng/µl in 50 mM aqueous ammonium bicarbonate and 5 mM CaCl2 ...
-
bioRxiv - Biochemistry 2023Quote: ... The central part of the DNA construct was obtained by digestion of a large homemade plasmid with BssHII (New England Biolabs) produced following published protocols (54) ...
-
bioRxiv - Microbiology 2023Quote: ... and assembled with pMV306hyg that was linearized by digestion with NcoI using HiFi DNA Assembly Master Mix (New England Biolabs) according to the manufacturer’s instructions followed by Sanger sequencing of the cloned gene ...
-
bioRxiv - Genetics 2024Quote: ... Primary restriction enzyme digest was performed using DpnII (Cat. No. R0543S) and secondary digestion with CviQI (Cat. No. R0639S) from NEB. Before sequencing a final cleanup using SPRI select beads from Beckman Coulter (Cat No ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around the miossa20 allele was amplified for 35 cycles using 57°C for annealing and identified by restriction enzyme digestion of the wild-type allele with BsaWI for 1 hour (New England BioLabs). The genomic region surrounding the spo11uc73allele was amplified for 35 cycles with an annealing temperature of 57°C and products were resolved without digestion48 ...
-
bioRxiv - Genomics 2024Quote: ... Resulting dsDNA was purified using a 1X SPRIbead clean-up within the 96-well plate, and the resulting product was subjected to USER digestion (80% ddH2O, 10% 10X rCutsmart, 10% USER enzyme (NEB)) ...