Labshake search
Citations for New England Biolabs :
451 - 500 of 2329 citations for Human GSDMC shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Using a plasmid linearized with SacI (New England Biolabs, Beverly, MA), it was transcribed with T7 polymerase (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid was digested with Xba1 and Ecor1 (New England Biolabs). mCherry was amplified with a 20 bp overhang ...
-
bioRxiv - Genetics 2020Quote: ... Plasmid act5c-Cas9 was digested with EcoRI-HF and XhoI (NEB) and the plasmid backbone was gel purified ...
-
bioRxiv - Bioengineering 2021Quote: ... digestion to remove the parental plasmid followed by NEBHiFi assembly (NEB) to assemble and seal the overlapping ends for improved transformation efficiency ...
-
bioRxiv - Neuroscience 2021Quote: ... Both plasmids were digested with SacI and PstI (New England BioLabs) to obtain fragments containing the vector backbone CD68 promoter and the DIO-eGFP insert ...
-
bioRxiv - Cell Biology 2021Quote: ... the listed plasmids were linearized using BsaBI (New England Biolabs, R0537S) and integrated at the endogenous TUB1 locus by homologous recombination.
-
bioRxiv - Biochemistry 2021Quote: This plasmid was created using NEBuilder HiFi DNA assembly protocol (NEB). In short ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids were made by Gibson assembly cloning (NEB BioLabs, Ipswich, MA). Synthetic DNA fragments were obtained from IDT (Coralville ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids were made by Gibson assembly cloning (NEB BioLabs, Ipswich, MA). Synthetic DNA fragments were obtained from IDT (Coralville ...
-
bioRxiv - Systems Biology 2021Quote: ... coli clones using the Monarch Plasmid Miniprep Kit (New England BioLabs).
-
bioRxiv - Microbiology 2021Quote: ... This plasmid was further modified using Q5 Site Directed Mutagenesis (NEB) to add the custom adaptors ACACTCTTTCCCTACACGACGCTCTTCCGATCT and GATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Genomics 2021Quote: ... and used to assemble plasmid pools with Gibson assembly (NEB, E2611L). Pools were assembled across 16 Gibson assembly reactions (~900 ng backbone ...
-
bioRxiv - Neuroscience 2020Quote: ... The pTRIP-Ef1α plasmid was linearized by digestion with MluI (NEB), blunted ...
-
bioRxiv - Microbiology 2021Quote: ... the CRISPRi plasmid backbone was digested with BsmBI-v2 (NEB #R0739L) and gel purified ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid DNA from single clones of transformed E.coli (New England Biolabs) was analysed for correct orientation of the insert by Sanger sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... followed by ligated to linearized plasmid using T4 DNA ligase (NEB). For site-directed mutagenesis ...
-
bioRxiv - Microbiology 2021Quote: ... and the Monarch plasmid miniprep kit (New England BioLabs, Ipswich, MA) used for plasmid purification ...
-
bioRxiv - Microbiology 2020Quote: ... and Monarch® Plasmid miniprep Kit (New England BioLabs, Ipswitch, MA) was used for purification of plasmid for gene expression and construction of complement mutant ...
-
bioRxiv - Microbiology 2019Quote: ... plasmids containing sgRNAs were co-transfected with NotI (New England Biolabs)-linearized pTKO ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid was linearized by restriction digest with SpeI (NEB, #R0133) for templated in vitro transcription.
-
bioRxiv - Cell Biology 2022Quote: ... This plasmid was constructed by HiFi- mediated in vitro recombination (NEB) of two PCR based fragments generated by amplifying the pN-PITCh-GFP (Addgene plasmid #127888 ...
-
bioRxiv - Synthetic Biology 2022Quote: Plasmids were assembled using Gibson assembly (New England Biolabs, Cat#E2611S) and purified using a Qiagen QIAfilter Midiprep Kit (QIAGEN ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were transformed into either competent NEB 5-alpha F’Iq (NEB) or Epi400 (Lucigen) ...
-
bioRxiv - Microbiology 2022Quote: ... counter-selectable mutagenesis plasmid pIMAY with T4 DNA ligase (NEB M0202)18 ...
-
bioRxiv - Biochemistry 2022Quote: ... The derivative pT7-spacer-gRNA plasmids were digested with HindIII (NEB) to permit run-off transcription near the 3’ end of the SpCas9 gRNA ...
-
bioRxiv - Biochemistry 2022Quote: ... the plasmid coding for segment 10 was linearized with BsaI (NEB), and the plasmids coding for the remaining segments were linearized using BsmBI (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... All these plasmids were produced by Gibson Assembly (New England Biolabs) after amplification by PCR of mGlu5 ...
-
bioRxiv - Developmental Biology 2021Quote: ... These plasmids were then double digested by SalI and NotI (NEB), and the fragment containing CMV promoter and coding sequence were purified and 0.5 nl of a 200ng/μl ...
-
bioRxiv - Microbiology 2020Quote: ... pMQ30MRR1 complementation plasmids was digested with Not1-HF (New England BioLabs) for transformation.
-
bioRxiv - Microbiology 2020Quote: ... MRR1 complementation plasmids were linearized with Not1-HF (New England BioLabs), cleaned up the Zymo DNA Clean & Concentrator kit (Zymo Research ...
-
bioRxiv - Developmental Biology 2022Quote: The pEntr-EMS plasmid was generated from a HiFi reaction (NEB) using the pEntr3c Gateway cloning (Invitrogen ...
-
bioRxiv - Physiology 2022Quote: ... The pCMV-myc plasmid was digested with EcoRI (New England Biolabs). The PCR products and digested plasmids were electrophoresed ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid transformation was carried out according to the manufacturer’s protocol (NEB). The purification of PT-dependent restriction enzyme EcoWI was performed as previously described (21).
-
bioRxiv - Cancer Biology 2022Quote: ... the plasmid was linearized with BstEII-HF (NEB, Cat. No. R3162) and MluI-HF (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... and ligated into similarly digested plasmids using T4 DNA ligase (NEB). Ligation reactions were transformed into chemically competent TOP10 E ...
-
bioRxiv - Biochemistry 2019Quote: ... The plasmid pNZ-SV was amplified by Phusion DNA polymerase (NEB) with the primer pair infupNZ-SVfor and infupNZ-SVrev (Supplementary File 4 ...
-
bioRxiv - Biochemistry 2019Quote: ... The plasmid pNZ-SV10H was amplified by Phusion DNA polymerase (NEB) with the primer pair linpNZ-SVfor and linpNZ-SVrev (Supplementary File 4 ...
-
bioRxiv - Biochemistry 2019Quote: ... The plasmid pIL3BTC was digested with the restriction enzymes NotI (NEB) and BstXI (NEB ...
-
bioRxiv - Microbiology 2019Quote: Plasmids were constructed using the Gibson Assembly protocol (New England Biolabs). Primers were designed with http://nebuilder.neb.com ...
-
bioRxiv - Genomics 2019Quote: ... We then ligated the plasmid and inserts using T4 ligase (NEB) in a 1:3 ratio respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... The purified plasmid was subsequently cut using either EcoRI-HF (NEB) or SapI-HF (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids were purified and analyzed by BstEII digestion (New England Biolabs) for confirmation of correct construction and electroporated into electrocompetent E ...
-
bioRxiv - Genetics 2019Quote: ... after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, USA), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2020Quote: ... these plasmids were digested with BamHI and NotI (New England Biolabs) and subcloned into BamHI/NotI-digested pACT (Ohkawa et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... This plasmid was digested with MluI (New England Biolabs, Ipswich, MA), removing 74% of the arif-1 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The Monarch Plasmid Miniprep Kit (New England Biolabs, Ipswich, MA, USA) was used to isolate plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pNLrep plasmid was digested with KpnI and PsiI enzymes (NEB) giving a 6337 bp product ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid nicking with Nb.BssSI was carried out via manufacturer’s recommendations (NEB). Both reactions were incubated at 37 °C for 2 hours ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were constructed using Gibson Assembly (New England Biolabs, Ipswich, MA). Regions of plasmids constructed using PCR were verified by DNA sequencing ...
-
bioRxiv - Synthetic Biology 2020Quote: The pLib_sfGFP plasmid was first digested with SalI-HF (NEB#R3138S) and NheI (NEB# R3131S ...