Labshake search
Citations for New England Biolabs :
201 - 250 of 976 citations for Dl 4 Methoxyestradiol 13 14 15 16 17 18 13C6 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... End-repair/A-tailing was performed on 17 μL of ChIPed DNA using NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England BioLabs), followed by ligation (MNase_F/MNase_R ...
-
bioRxiv - Bioengineering 2022Quote: ... End-repair/A-tailing was performed on 17 μL of ChIPed DNA using NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England BioLabs), followed by ligation (MNase_F/MNase_R ...
-
bioRxiv - Molecular Biology 2022Quote: ... end-repair/A-tailing was performed on 17 µL of ChIPed DNA using NEBNext® Ultra™ II End Repair/dA-Tailing Module (New England BioLabs), followed by adapter ligation using T4 DNA Ligase (New England BioLabs) ...
-
bioRxiv - Genetics 2019Quote: ... Libraries were quantified using a Qubit fluorometer before an 18-cycle PCR amplification on bar-coded fragments with Phusion high-fidelity PCR Kit (New England Biolabs). The PCR products were cleaned using 1X vol of AMPure XP Beads.
-
bioRxiv - Molecular Biology 2019Quote: ... Luciferase activity was determined in a luminometer (Optocomp I) by the addition of ∼18 µl of sample to 6-7 µl diluted coelenterazine (for Gluc, NEB), or ∼20 µl of sample to 15-18 µl Fluc substrate (Promega).
-
bioRxiv - Genomics 2021Quote: ... and on the other side a primer that targets a region introduced through the library preparation called “Read 1” (18 cycles using NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... to the branch point recognition sequence (Nucleotides 18-42) of U2 snRNA and to GAPDH mRNA were added in combination with RNase H (NEB) to NE ...
-
bioRxiv - Neuroscience 2022Quote: ... was linearized for 18 hours at 37°C in a 250 μl reaction containing restriction enzyme NheI and CutSmart buffer (New England Biolabs). The linear DNA plasmid was next used to produce complementary RNA (cRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... mutants of UFD1-His6 (deletion of amino acids 2-215) and NPL4 (T590L+F591V point mutations) 18 were generated using the Q5 Site-Directed Mutagenesis kit (New England Biolabs).
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR-enrichment was performed in 18 cycles in ten 10μL reactions per sublibrary with Phusion® HF PCR Mastermix (New England BioLabs) by mixing 5µl 2× Phusion Master mix ...
-
bioRxiv - Biochemistry 2023Quote: ... the lysate was clarified by centrifugation at 5°C at 18 500 rpm for 30min and loaded onto gravity flow amylose resin (NEB) previously equilibrated with buffer WB1_1 (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 4: 4°C hold) using NEB Next High-Fidelity master mix (NEB) in 25 µl reaction volume using RAD-Marker for/ RAD-Marker rev primers (25 nM each ...
-
bioRxiv - Cell Biology 2020Quote: ... Oct-4 (NEB, D7O5Z), Sox2 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 ml ScaI (BioLabs), followed by 3 h of incubation with a fresh portion ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation reactions were conducted using 15 pmol of RtcB (NEB), 1x RtcB buffer (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... 0.025 mM dGTP and 15 U T4 DNA polymerase (NEB # M0203L). The samples were brought up to 50 µL total volume adding ultrapure distilled water ...
-
bioRxiv - Cell Biology 2022Quote: ... and amplified for 15 PCR cycles using Q5 polymerase (NEB, M0491). PCR products were run on a gel ...
-
bioRxiv - Biophysics 2019Quote: ... for 15 minutes at 12°C in 1x buffer 2.1 (NEB), to remove 3’-A overhangs.
-
bioRxiv - Molecular Biology 2023Quote: ... Viral cDNA was amplified for 15 cycles with Phusion polymerase (NEB) using a primer complementary to the adaptor (TGGATTGATATGTAATACGACTCACTATAGG ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µg of pUPRT plasmid was linearised with AgeI-HF (NEB) (GRA59 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1mM DTT) before adding 15 µl 1 mg/ml Streptavidin (NEB) before immediate wash with DLB-C-T buffer (DLB supplemented with 1 mg/ml α-casein ...
-
bioRxiv - Cell Biology 2023Quote: ... Klenow fragment (5 U) & T4 polynucleotide kinase (15 U) (NEB; M0201). The A-tailing was performed with Klenow exo-fragment (15 U ...
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed in 25 μL reaction volumes and contained 13 μL Q5® Hot Start High-Fidelity 2× Master Mix (New England Biolabs, US), 0.5 μM of each primer and 0.4 μL of 25 mg/mL BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 10 ng of library DNA was amplified with the p7 primer and the IS-Seq Step1 primer (Table S5) for 13 cycles using Q5 2X Master Mix (New England Biolabs, Ipswich, MA). These reaction products were diluted 1:100 and 10 µL was added to a PCR reaction with the p7 primer and the IS-Seq Step2 primer for 9 cycles using Q5 2X Master Mix ...
-
bioRxiv - Genomics 2019Quote: ... Libraries were produced by PCR amplification (12-14 cycles) of tagmented DNA using the NEB Next High-Fidelity 2x PCR Master Mix (New England Biolabs). Library quality was assessed in an Agilent Bioanalyzer 2100 ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... The DNA samples incubated for primer extension as described previously (14) were treated with dA-Tailing Module (New England Biolabs) and NEBNext Quick Ligation Module (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... was amplified using oAC158/oAC159 and inserted into BamHI digested miniCTX1-optRBS-lacZ (14) using isothermal assembly (Gibson Assembly Master Mix, New England BioLabs). The reactions were transformed into chemically competent DH5α and selected for on tetracycline ...
-
bioRxiv - Developmental Biology 2022Quote: ... and T492 were created through PCR mutagenesis of an intron-less version of pHC329 using the oligonucleotides (#1-14) and HiFi assembly (NEB) (Fig ...
-
bioRxiv - Microbiology 2020Quote: ... Ligation of the product and linearized vector was performed overnight at 14°C with T4 DNA ligase (New England Biolabs). The resulting construct was transformed into DH5α Escherichia coli by heat shock and transformants were obtained by selection on LB agar with carbenicillin and X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside ...
-
bioRxiv - Microbiology 2021Quote: ... The 37-mer (50 μM) and the 14-mer (20 μM) RNAs were mixed with Vaccinia Capping Enzyme buffer (NEB), 2 mM SAM ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Microbiology 2022Quote: ... These vectors were generated by mutating the sgRNA site in the pSag1-Cas9-U6-sgUPRT-HXG plasmid [14] using the Q5 Site-Directed Mutagenesis Kit (NEB). The two guide RNAs were designed to target TgEFP1 at either of the predicted EF-hand domains using the online E-CRISP tool (http://www.e-crisp.org/E-CRISP/) ...
-
bioRxiv - Microbiology 2021Quote: ... Ligation to each splint was performed overnight at 16°C using T4 DNA ligase (New England Biolabs).
-
bioRxiv - Molecular Biology 2021Quote: ... Digested chromatin was then ligated at 16 °C with 10000 U of T4 DNA ligase (NEB, M0202) in ligase buffer supplemented with 10% Triton-100 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... 16 μg of sonicated DNA was subjected to RNase H (NEB, 1.5 U per μg of DNA) treatment or RNase H buffer only for 4 hr at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... Digested chromatin was then diluted and ligated overnight at 16°C with T4 DNA ligase (NEB, M0202M). Reversal of crosslinks ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Restriction digested chunks were ligated over night at 16°C using T4 DNA ligase (New England Biolabs).
-
bioRxiv - Genomics 2023Quote: ... This 17 µl of DNA solution was incubated with 3 µl digestion mixture containing 1 µl BciVI (New England Biolabs, cat. no. R0596S) and 2 µl CutSmart buffer (New England Biolabs ...
-
bioRxiv - Developmental Biology 2020Quote: Alg2 cDNA was amplified with RT-PCR from the cDNA of wt Oryzias latipes Cab strain stage 18 embryos with Q5® High-Fidelity DNA Polymerase (New England Biolabs) by using primers with BamHI-HF (New England Biolabs ...
-
bioRxiv - Cell Biology 2019Quote: ... 500ng of RNA from MEFs or 350ng of RNA from BMDMs were reverse transcribed using oligo(dT)18 primer (New England Biolabs, #513165) and SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Systems Biology 2021Quote: Rho libraries were amplified using primers MO574 and MO575 (Supplementary file 6) for 6 cycles at an annealing temperature of 66C followed by 18 cycles with no annealing step (NEB Phusion) and then purified with the Monarch PCR kit (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated at 37°C for 18 hours and the plasmid was extracted using the Monarch Plasmid Miniprep Kit (New England Biolabs, US) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... were incubated with 25 μL of containing TF or 18S primers and fluorescent Luna® Universal qPCR Master Mix (New England Biolabs), and qRT-PCR was carried out in triplicate for each sample on the CFX Connect real-time System (Bio-Rad Laboratories).
-
bioRxiv - Microbiology 2023Quote: ... The pellet was resuspended in 20 µl of distilled water and mixed with 18 µl gel loading dye (New England Biolabs, Inc.). Samples were resolved in a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Genomics 2023Quote: ... Amplification of the libraries was performed for 13 PCR cycles using the Phusion High-Fidelity PCR Master Mix (New England Biolabs, cat. no. M0531L); 6-bp molecular barcodes were also incorporated during this PCR amplification ...
-
bioRxiv - Molecular Biology 2023Quote: ... and produced by PCR amplification (10–13 cycles) of tagmented DNA using a NEB Next High-Fidelity 2× PCR Master Mix (New England Biolabs, Ipswich, MA, USA). DNA fragments were then purified using the MinElute PCR Purification Kit and eluted in 10 µL elution buffer ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation reactions were conducted using 15 pmol of RtcB ligase (NEB), 1x RtcB buffer (NEB) ...
-
bioRxiv - Bioengineering 2021Quote: Escherichia coli strains DH5α [15] and ER2523 (New England Biolabs, Ltd., UK) were grown in Luria Bertani (LB ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 μg protein was mixed with 15 μL Glycoprotein Denaturing Buffer (NEB) in 150 μL total volume and incubated at room temperature for 10 min ...